fitness sexual function and a satisfying sexual relationship
Tài liệu Báo cáo khoa học: Second messenger function and the structure–activity relationship of cyclic adenosine diphosphoribose (cADPR) doc
... of Ca2+ channels, either localized in the membranes of intracellular Ca2+ stores or in the plasma membrane Such Ca2+ entry channels in the plasma membrane and Ca2+ release channels in intracellular ... skeletal and cardiac muscle, neuronal and neuronal-related cells, hemopoietic cells, acinar cells, and oocytes (for a more complete list see [15]) Because the cADPR ⁄ Ca2+ signalling system was also ... that cADPR, in addition to Ca2+ release, also promotes Ca2+ entry What are the underlying mechanisms? A mechanism generally assumed to play a role in nonexcitable cells is the capacitative Ca2+...
- 8
- 469
- 0
Tài liệu SEXUAL HEALTH EDUCATION A T SCHOOL AND A T HOME: ATTITUDES AND EXPERIENCES OF NEW BRUNSWICK PARENTS pptx
... homosexuality and relationships have no place in an academic institution Issues such as avoiding sexual abuse and awareness of The Canadian Journal of Human Sexuality, Vol 11 (1) Spring 2002 Table ... rural Ontario (McKay et al., 1998) and 95% in rural Nova Scotia (Langille et al., 1996), and suggests that the fears teachers and administrators have of parental and community opposition may ... dreams, birth control methods and safer sex practices, sexuality in the media, masturbation, sex as part of a loving relationship, attraction, love, and intimacy, homosexuality, sexual behaviour,...
- 13
- 473
- 0
Báo cáo y học: " High blood pressure, antihypertensive medication and lung function in a general adult population"
... and antihypertensive medication are highly correlated A detailed analysis of antihypertensive medication indicates that BBL medication and not any other antihypertensive medication is associated ... medication showed that both BBL and other antihypertensive medication, as for example ACE inhibitors, angiotensin antagonists, diuretics or calcium antagonist, are associated with reduced FEV1 and ... lifestyle and health related factors, medical history and respiratory symptoms were performed Cardiovascular (heart attack, stroke) and pulmonary diseases (asthma, chronic bronchitis) were based on self-reported...
- 8
- 579
- 1
RELATIONSHIP BETWEEN ALLOCHTHONOUS DOC CONCENTRATION AND A SPECIFIC UV254 ABSORBANCE (SUVA) AT A MESO-STRATIFIED RESERVOIR
... Reservoir area Watershed area Reservoir length Average depth Water capacity Effective capacity Yearly average inflow, outflow Hydraulic residence time Urban area in drainage basin Paddy area in drainage ... season All data Upper layer Wet season Dry season Middle layer Wet season Dry season Bottom layer Wet season Dry season All data at Jannge site Wet season Dry season All data at Jannge site Wet season ... lower layer was similar As a result, condition of both DOC and UVA254 at middle and bottom layer was almost homogenous and the extent of NOM in wet season was about times greater than that in...
- 7
- 428
- 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... pAM237 pAM241 pAM252 pAM253 pAM872 pAM873 pAM874 pAM875 pAM876 pAM877 pAM878 pAM879 pAM880 pAM881 pAM882 pAM883 pAM884 pAM885 pAM886 pAM887 pAM888 pAM889 pAM890 pAM891 pAM892 pAM895 pAM896 pAM899 ... GFP-specific antiserum was a gift from J Kahana and P Silver (Dana Farber Cancer Center, Boston, MA) The anti-actin mAb was MAB1501 from Chemicon International (Temecula, CA) The anti-hexokinase rabbit ... bar1) [23], IDY166 (MATa his3 leu2 ura3 trp1 las17D::URA3) [20], and PJ69- 4A (MATa his3 leu2 ura3 trp1 gal4D gal80D met2::GAL7-lacZ GAL2-ADE2 LYS2::GAL1–HIS3) [64] Yeast strain PJ69- 4A was a...
- 23
- 679
- 0
Tài liệu Báo cáo khoa học: Relationships between structure, function and stability for pyridoxal 5¢-phosphate-dependent starch phosphorylase from Corynebacterium callunaeas revealed by reversible cofactor dissociation studies doc
... Analytical enzymes and enzyme substrates were specied in previous papers [1518] All other chemicals were of reagent grade and obtained from Sigma and Fluka Preparation of apo-Cc StP and apo-Ec MalP ... recovered activity to Eqn (4) and are summarized in Table They reveal marked decreases in the apparent afnities of the R23 4A and R24 2A mutants for phosphate, compared to wild-type DEA ẳ DEAmax ẵPi ... details of the fractionation Fractions are labeled according to Fig KmG6 and KiG6 were obtained from nonlinear ts to Eqn (2) of the initial rate data recorded at a constant saturating concentration...
- 11
- 636
- 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, ... Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria ... characteristics of transthyretins and TLPs are indicated above the alignment: motifs A –C’ are indicated with straight lines and are labelled; b-strands are indicated with arrows and are labelled...
- 13
- 390
- 0
Báo cáo khoa học: Interactions between metals and a-synuclein ) function or artefact? pptx
... to cause disease These mutations are associate with early onset of the disease and has the pathology includes LBs and is autosomal dominant [21] a- synuclein a- synuclein is a small (14 kDa), highly ... to the parkinsonian neurotoxin MPTP Proc Natl Acad Sci USA 99, 14524–14529 43 Chandra S, Fornai F, Kwon HB, Yazdani U, Atasoy D, Liu X, Hammer RE, Battaglia G, German DC, Castillo PE et al (2004) ... oxidation and nitration can also increase the rate of conversion [76] Binding of polyanions to the C-terminal domain can also catalyse protein aggregation [58] Current research has suggested that...
- 9
- 467
- 0
Internal audit in banks and the supervisor’s relationship with auditors: A survey pdf
... systems and procedures, to analyse the organisational structures with a critical mind, and to evaluate the adequacy of the methods and resources, in relation to the assignment; and • a management audit ... internal audit In this regard, the survey inquired about the way internal audit departments are organised, particularly for larger international banks and for banks that are part of financial conglomerates ... mentioned are financial audit, compliance audit, operational audit and management audit.4 Management audits are performed less frequently than the other types of audits 37 Banks report that their audit...
- 16
- 522
- 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
... b-sandwich, a core (which contains a transamidation site and a Ca2+-binding site, and has a helices and b sheets in equal amounts), and two C-terminal b-barrel domains It has been suggested that glutamyl ... the coagulating gland [129] FXIII Coagulation FXIII is a plasma TG, and circulates in blood as a heterotetramer consisting of two catalytic A (XIIIA) and two noncatalytic B (XIIIB) subunits Table ... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes...
- 17
- 440
- 0
Báo cáo khoa học: An asymmetric ion channel derived from gramicidin A Synthesis, function and NMR structure ppt
... around 222 nm (Fig 3A) indicates a random-coil structure In methanol, two positive maxima were observed at 209 and 230 nm (Fig 3A) These two maxima are characteristic of a parallel right-handed ... long-range NOEs observed can be ascribed to two types: those between aHi and NHi+6 (i ¼ 1, 3, and for chain A, and 1, 3, 5, 7, and for chain B); and those between aHi and NHi-6 (i ¼ 10 and for chain ... the standard library of dyana In the 3–Cs+ complex, chains A and B are connected head-to-head by succinic acid, in such a way that the molecule entity starts from a C-terminus and ends at another...
- 12
- 446
- 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
... insulin pharmacophore, IleA2-ValA3 at the A- chain N-terminus, TyrA19 at the A- chain C-terminus, and ValB12 and TyrB16 at the B-chain central helix assume essentially the same spatial arrangements ... residues at the A- chain N-terminus (GlyA1–IleA2–Val1 3A) [24,25], the A- chain C-terminus (TyrA19 and AsnA21) [26], the B-chain central helix (ValB12 and TyrB16) [27], and the B-chain C-terminal b strand ... PCR strategy using the azuki bean and mung bean genomic DNAs as templates and the synthetic primers legF1 (5¢-AGC AGCAGATTGTAATGGTG-3¢) and legR1 (5¢-CAGC ACTTCAGAATCAGAGTC-3¢) PCR products were...
- 8
- 386
- 0
báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc
... Table 3: Mean item-total correlation and Cronbach's alpha for domain scores in the NFAS-4 and the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... data quality and the thorough testing of validity against other standards The moderate response rate and that all data is self-reported, represent study limitations An external, unrelated variable ... Table 2: Missing data, means and end effects for NFAS-4 and NFAS-5 items (N = 3325) Missing % NFAS-4 NFAS-5 Walking/standing Standing Walking less than a kilometre on flat ground Walking than...
- 9
- 489
- 0
Báo cáo hóa học: " Respiratory function and bronchial responsiveness among industrial workers exposed to different classes of occupational agents: a study from Algeria" potx
... to moderate physical activity; symptoms suggesting asthma or allergy, the use of medication for asthma or allergy, and the presence of hay-fever and nasal allergies Asthma was defined as answering ... questionnaires and spirometry Forced vital capacity (FVC) and Forced expiratory volume in one second (FEV1) are currently the best available functional measures and predictors of respiratory (and ... spirometry and bronchial reactivity to histamine and constructed the database TN and PH did the statistical analysis On the basis of both PD20 and the AUC method for expressing bronchial responsiveness,...
- 8
- 377
- 0
báo cáo hóa học: " A new generalization of the Riemann zeta function and its difference equation" docx
... Department of Mathematics and Statistics, King Fahd University of Petroleum and Minerals, Dhahran 31261, Saudi Arabia 2Center for Advanced Mathematics and Physics, National University of Science and Technology ... H-12, Islamabad, Pakistan Authors’ contributions All authors contributed equally to the manuscript and read and approved the final draft Competing interests The authors declare that they have no ... eFD functions had been put forward as possible candidates for the anyon function as they interpolate very naturally between the BE and FD functions The above connections enable us to obtain an asymptotic...
- 13
- 438
- 0
Báo cáo hóa học: " A Sigma-Delta ADC with Decimation and Gain Control Function for a Bluetooth Receiver in 130 nm Digital CMOS" pdf
... matching can be easily achieved without dramatically increasing unit capacitance Based on behavioral-level simulations, the minimum allowable capacitance value was chosen Six-phase clock signals ... substrate as the digital core, digital circuit noise coupling through the substrate and supply rails was carefully considered as an important design and layout parameter Layout considerations are also ... applied as input Matlab simulations indicate that more than 80 dB attenuations can be achieved at the folding frequency band edge (36.5 MHz, since MHz is the signal bandwidth) Capacitor mismatches...
- 8
- 280
- 0
Báo cáo y học: "Hypothalamic-pituitary-adrenal stress axis function and the relationship with chronic widespread pain and its antecedent" pdf
... widespread pain and HPA axis function is therefore unclear and remains to be clarified The studies discussed above were conducted on small numbers of patients, which may have had an impact on the accuracy ... identified based on their pain and psychological status and whose HPA axis function was assessed Subjects completed a questionnaire that enquired about aspects of psychological status together with a history ... responsible for study conduct and manuscript revisions JM conducted data analysis and prepared the manuscript All authors have access to all data in the study and hold final responsibility for the...
- 9
- 297
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... Primers and probes 11β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC ... GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC ... CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer: TGGACAAGAACAGCAACGAG Reverse primer: TTGTCACTGGTCAGCTCCAG...
- 10
- 438
- 0
Form And Function In A Legal System - A General Study Part 1 pdf
... of major legal thinkers, such as H L A Hart and Hans Kelsen Here, each paradigm of an overall form of a functional legal unit is defined and differentiated from the complementary material and ... methodologies, and sanctions Also, I seek to advance and to render more articulate our general understanding of the distinctive nature of each selected functional legal unit as a whole through a frontal and ... forms” that unduly sacrifice important values, as in the case of administrative agencies that have jurisdictional and structural features in which adjudicative and administrative functions are not...
- 43
- 252
- 0
Form And Function In A Legal System - A General Study Part 2 pps
... “overall form” as the purposive systematic arrangement of a functional legal unit is analogous Just as the form of a table may be said to arrange and shape the wood, and the form of a citadel may ... said to arrange and shape the building materials, and just as both can also be said to be so arranged and shaped purposively and systematically, the form of a legislative institution, for example, ... supra n 2, vol 6, at “form” I.13; id., vol 6, at “formal” A. 3 .a P Atiyah and R Summers, Form and Substance in Anglo-American Law: A Comparative Study of Legal Reasoning, Legal Theory, and Legal...
- 43
- 294
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25