fill each blank with a suitable word phrase various tuition preparatory aid private available grade prepare
Unit 3 curriculum ppt
Ngày tải lên :
23/08/2015, 13:25
... decisions and how teaching and learning take place What are the roles of the teachers in school? Teachers play a significant role in curriculum design and teaching Task 6: Translate the following ... sports, drama, music, dance, swimming, table tennis, volleyball and various clubs are an important part of the educational experience Participating in extracurricular activities enhances both ... Mathematics and Literature are compulsory for all students from grade to grade 12 The other foundation subjects are compulsory at one or more Key Stages: Literature (Vietnamese) Mathematics (algebra,...
- 28
- 254
- 0
Báo cáo khoa học: Amino acid residues on the surface of soybean 4-kDa peptide involved in the interaction with its binding protein potx
Ngày tải lên :
17/03/2014, 03:20
... N-terminal primer: 5¢-AAC CAT GGC TAA AGC AGA TTG TAA TGG TGC ATG T-3¢; C-terminal primer: 5¢-AAG AAT TCT TAT TAT CCA GTT GGA TGT ATG CAG AA-3¢ The amplified sequence was cloned into plasmid pET3 2a( +), ... room temperature and incubated with goat anti-(rabbit IgG) labeled with alkaline phosphatase The signal was detected with BCIP/NBT membrane phosphatase substrate (KPL, Gaithersburg, MD, USA) Construction ... sensorgram data was carried out according to global fitting, and the ka and kd values were calculated with a : Langmuir model using the BIAEVALUATION software, version 3.2 RC2 (Biacore) The dissociation...
- 10
- 420
- 0
MATCH THE PRONOUNS WITH THEIR POSSESSIVES
Ngày tải lên :
27/08/2016, 16:05
... teacher She goes to school with (she) brother (They) father works in a car factory (You) laptop is very expensive (He) favorite hobby is tennis (I) husband and I want ... John has a brother brother is 25 years old Her Your His I want to phone Sarah Do you know telephone number? its her your REPLACE THE PERSONAL PRONOUNS BY POSSESSIVE ADJECTIVES ... tennis (I) husband and I want to go to Paris We want to see (it) historical monuments Leila likes (she) dog ! (It) name is Bobby LET’S DRAW THEM!!! ...
- 2
- 159
- 0
Tài liệu Báo cáo khoa học: Delineation of exoenzyme S residues that mediate the interaction with 14-3-3 and its biological activity ppt
Ngày tải lên :
19/02/2014, 08:20
... GST-ExoS(D42 7A) 17 GST-ExoS(L42 8A) 18 GST-ExoS(LD426–427AA) Amersham S419QGLLDALDL428 M419AAAA428 S419QGLLDAAAA428 S419QGLLAAAAA428 S419QGLLAALAL428 I419QGLLDALDL428 S419AGLLDALDL428 S419QALLDALDL428 ... are substituted with alanine and residues 424–428 have been deleted [14] (Fig 1, compare lane with lanes and 4) We also observed that both GST-ExoS(DALDL424–428AAAAA) and GST-ExoS(LDL426–428AAA) ... has created a new way to take advantage of an evolutionary ‘novel’ eukaryotic 14-3-3 protein family, using them as a necessary cofactor to activate lethal bacterial toxins, 644 but only after...
- 9
- 525
- 0
Tài liệu MECHANICAL PROPERTIES OF THE HEART AND ITS INTERACTION WITH THE VASCULAR SYSTEM ppt
Ngày tải lên :
22/02/2014, 09:20
... readily appreciated that with each cardiac cycle, the muscles in the ventricular wall contract and relax causing the chamber to stiffen (reaching a maximal stiffness at the end of systole) and ... roughly equal to the pressure existing in the left atrium (LAP) at that instant in time (recall that atrial pressure is not a constant, but varies with atrial contraction and instantaneous atrial volume) ... parameters regulate cardiovascular performance will be reviewed: a classical approach, commonly referred to as Frank-Starling Curves, and a more modern approach based upon pressure-volume analyses...
- 23
- 578
- 0
Báo cáo khoa học: Intermonomer cross-linking of F-actin alters the dynamics of its interaction with H-meromyosin in the weak-binding state ppt
Ngày tải lên :
16/03/2014, 13:20
... (p-PDM), ATP, ADP were from Sigma Chemical Co., (St Louis, MO) All other reagents were of analytical grade Ca2+-independent bacterial transglutaminase was a generous gift from K Seguro (Ajimoto ... adenosine 5¢[bc-imido] triphosphate (AMPPNP) complex was used as HMM ⁄ ATP state and HMM ⁄ ADP ⁄ AlF4 complex represents a stable analogue of HMM ⁄ ADP ⁄ Pi state The half-life of the ADP ⁄ AlF4 ... all actin samples within the limits of experimental error The standard deviations are 0.025 mT H par k and H per k mean that the longer axis (k) of the actin filaments was oriented either parallel...
- 10
- 311
- 0
Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail pdf
Ngày tải lên :
23/03/2014, 09:20
... vector as template DNA Primer 1, 5Â- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3Â, was designed to add a sequence encoding Apamin and a linker cleavable by thrombin and Fx proteases at an ... Membrane protein concentration was determined by a Bio-Rad (Hercules, CA, USA) Protein Assay, using bovine serum albumin as standard Radioiodinated LqhaIT was prepared by lactoperoxidase (Sigma, ... mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal structures of a- toxins and their mutants...
- 14
- 206
- 0
the option course with exercise
Ngày tải lên :
23/04/2014, 15:58
... Discussion: Large-cap stocks represent companies with a capitalization of more than $5 billion Also commonly referred to as blue chips, large caps are generally mature companies that are regarded as safe ... are traded on the major exchanges and provide regular dividends to shareholders—perhaps their most appealing advantage Mid-cap companies have a market capitalization of between $500 million and ... and a trader? Answer: An investor takes a long-term, passive approach A trader takes a more active approach using various options strategies that tend to capitalize on shorter-term market movement...
- 237
- 280
- 0
Báo cáo sinh học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" potx
Ngày tải lên :
18/06/2014, 18:20
... Taruishi M, Sungdee A, Pattamadilok S, Ibrahim IN, Erlina S, Agui T, Yanagihara R, Arikawa J: Development of serological assays for Thottapalayam virus, an insectivore-borne Hantavirus Clin Vaccine ... 2005, 5:773-790 Milazzo ML, Cajimat MN, Hanson JD, Bradley RD, Quintana M, Sherman C, Velasquez RT, Fulhorst CF: Catacamas virus, a hantaviral species naturally associated with Oryzomys couesi ... SK, Vaheri A, Plyusnin A: L protein, the RNA-dependent RNA polymerase of hantaviruses Arch Virol 2005, 150:533-556 Chandy S, Mitra S, Sathish N, Vijayakumar TS, Abraham OC, Jesudason MV, Abraham...
- 5
- 406
- 0
Báo cáo hóa học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" pdf
Ngày tải lên :
20/06/2014, 01:20
... Taruishi M, Sungdee A, Pattamadilok S, Ibrahim IN, Erlina S, Agui T, Yanagihara R, Arikawa J: Development of serological assays for Thottapalayam virus, an insectivore-borne Hantavirus Clin Vaccine ... 2005, 5:773-790 Milazzo ML, Cajimat MN, Hanson JD, Bradley RD, Quintana M, Sherman C, Velasquez RT, Fulhorst CF: Catacamas virus, a hantaviral species naturally associated with Oryzomys couesi ... SK, Vaheri A, Plyusnin A: L protein, the RNA-dependent RNA polymerase of hantaviruses Arch Virol 2005, 150:533-556 Chandy S, Mitra S, Sathish N, Vijayakumar TS, Abraham OC, Jesudason MV, Abraham...
- 5
- 316
- 0
Báo cáo hóa học: " Research Article A Hilbert-Type Linear Operator with the Norm and Its Applications" pdf
Ngày tải lên :
22/06/2014, 02:20
... Journal of Inequalities and Applications, vol 2008, Article ID 917392, 12 pages, 2008 18 B C Yang, A more accurate Hardy-Hilbert-type inequality and its applications,” Acta Mathematica Sinica, ... Inequalities and Applications, vol 2008, Article ID 637397, 10 pages, 2008 C.-J Zhao and L Debnath, “Some new inverse type Hilbert integral inequalities,” Journal of Mathematical Analysis and Applications, ... theoretical analysis and applications These inequalities and their integral forms have been recently extended or strengthened in 4–8 Zhao and Debnath obtained a Hilbert-Pachpatte’s reverse inequality...
- 18
- 253
- 0
THE THIRTEENTH CENTURY.—THE MANOR AT ITS ZENITH, WITH SEEDS OF DECAY ALREADY VISIBLE.—WALTER OF HENLEY pdf
Ngày tải lên :
29/06/2014, 15:20
... quarter of wheat or rye for 2d and a quarter of oats for 1d A sow ought to farrow twice a year, having each time at least pigs; and each goose goslings a year and each hen 115 eggs and chicks, ... clear for each cow and the tithe, and for a sheep 6d and the tithe, and a sow should bring you 6s 6d a year and acquit the tithe, and each hen 9d and the tithe; and Walter says, 'When I was bailiff ... waste meadow for 31/2d.And know that men can well reap and bind acres a day of each kind of corn, and where each takes 2d a day then you must give 5d an acre.'[88] 'One ought to thresh a quarter...
- 19
- 291
- 0
Báo cáo y học: "Hypothalamic-pituitary-adrenal stress axis function and the relationship with chronic widespread pain and its antecedent" pdf
Ngày tải lên :
09/08/2014, 06:23
... assumptions about individual variable interactions Conventionally, eigenvalues over are said to explain more of the variance than the raw data alone For analysis, the resulting principal component ... development and design All authors were responsible for study conduct and manuscript revisions JM conducted data analysis and prepared the manuscript All authors have access to all data in the study and ... which are calculated for each subject PCA analysis produces eigenvalues, a measure of the variance that is explained by the individual components Importantly, PCA does not require prior assumptions...
- 9
- 297
- 0
báo cáo khoa học: " The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity" pdf
Ngày tải lên :
12/08/2014, 03:21
... [39] with either primer pairs GFP-BAM (5’-GCGGATCCGATGAGTAAAGGAGAAGAAC-3’) and GFP-KPN (5’-GCGGTACCATGAGTAAAGGAGAAGAAC-3’), or GFP-BGL (5’-GCAGATCTGTATAGTTCATCCATGCC3’) and GFP-ECO (5’-GCGAATTCGCTTGACTCTAGCTTATTTG-3’), ... E122SRV (CGACGATGTAGTAGCTGATCAGGGGGGAGGTAGTCCAACC); for the E214Q mutation, E214QFW (CCAAATTGTTGCTGTTCAGGGTTACCAAAGCAGTGGATCCG) and E214QRV (CGGATCCACTGCTTTGGTAACCCTGAACAGCAACAATTTGG); and for the ... Havana, and two local varieties, Alcalá and Paraíso The diameter of infection areas for the two local varieties were about half the value obtained for Havana, and similarly, Xyn1 1A induced a...
- 15
- 261
- 0
promoting truth-telling (the concept and its practice) with effective communication in medical settings
Ngày tải lên :
22/12/2014, 16:53
... USA, and Japan, and any other related problems The articles in Japanese that I have studied in detail include those from academic journals on terminal patients and patients at the end of life with ... defendant surgeon denied liability He admitted having diagnosed a cancerous growth in the bladder, but he pleaded that he did so after a careful manual and visual examination of the bladder and after ... I examine qualitative research as well as quantitative research into these practices, as published in major journals and books both in Japanese and in English The chapter begins with Japanese...
- 229
- 1.3K
- 0
substitution as a grammatical cohesive device in english narrative in comparision with its translation into vietnamese = phép thế như phương tiện liên kết ngữ pháp trong văn trần thuật tiếng anh
Ngày tải lên :
28/02/2015, 11:54
... corpora have a digital format and are available on the internet Detailed information about the translations was not available In the study, both quantitative and qualitative methods were adopted ... written language, it is important to maintain enough information, appropriate grammatical structures as well as rational organization of sentences Grammatical metaphor: Written language presents rather ... therefore of great importance to language teaching In the early days, language teaching has been concerned with pronunciation, grammar and vocabulary; however, it was not until Discourse Analysis turned...
- 41
- 750
- 2
a study on connotative equivalence between gone with the wind and its translation in vietnamese by duong tuong = nghiên cứu tương đương biểu cảm giữa tác phẩm cuốn theo chiều gió
Ngày tải lên :
02/03/2015, 14:20
... original within the constraints of the target language grammatical structures Cultural words are transferred and grammatical and lexical "abnormality" are preserved in the translation 1.4.4 Semantic ... procedure, a source language cultural word is translated by a target language cultural word The translation uses are quite limited as they are not accurate but approximate cultural equivalents However, ... “interchangeable in a given situation” and this happens when a source language and a target language text or item are relatable (at least some of) the same features of substance” (Catford, 1965,...
- 77
- 1.2K
- 3
The Policy on Education of the Disabled in Vietnam - The Gaps and Its Impact on the Persons with Disability
Ngày tải lên :
09/03/2015, 16:52
... being asked about the working conditions in teaching PWD, 36,9% teachers said lacking of reference materials, 33,9% teachers said lacking of technical documents, 33.9% said lacking of area and ... State Agency for International Development (USAID) and Vietnam Assistance for the Handicapped (VNAH) - and facilitated by and in partnership with Ministry of Education and Training (MOET) The authors ... special education and one on inclusive education in Danang and Vinh Long respectively Data collection The survey was conducted with qualitative and quantitative approaches The quantitative approach...
- 10
- 727
- 0
Using supplementary reading materials with the course book business basics to improve the efficiency of reading teaching and learning for second - year students at Bac Ha College of Technology
Ngày tải lên :
04/08/2015, 09:42
... „Recent materials for the teaching of reading‟ English Language Teaching Journal, 39 (3) Nuttall, C (1996) Teaching Reading Skills in a Foreign Language Oxford: MacMillan Heinemann Paris, S G., Wasik, ... language teaching Edinburgh Nunan, D (1991) Language Teaching Methodology A Textbook for Teachers PrenticeHall Nunan, D (1998) Second Language Teaching and Learning Boston: Heinle & Heinle Nuttall, ... for the teachers to provide them as many opportunities to read as possible Nuttall in the book “Teaching reading skills in a foreign language” (1982) states that “reading as a purposeful activity,...
- 5
- 608
- 3