0

fear as a ruling passion xxiii fighting among wild animals xxiv wild animal criminals and crime xxv fighting with wild animals

báo cáo hóa học:

báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

Hóa học - Dầu khí

... one-year follow up was assessed using a 7-day point prevalence analysis [16] Discharge was assessed both after BMT and after technical training school, the second level training after BMT, and ... self-rated general health and important medical endpoints [1,5,6] Given its brevity and apparent validity as a marker for health and health behaviors, self-rated health may prove to be a useful ... were not married (> 90%) and approximately one-fifth (21.1%) had attended at least some college Minority representation was high among all participants, particularly among females where almost 26%...
  • 9
  • 301
  • 0
Frailty as a predictor of future falls among community dwelling older people  a systematic review and meta analysis

Frailty as a predictor of future falls among community dwelling older people a systematic review and meta analysis

Tổng hợp

... Samper-Ternent R, Karmarkar A, Graham J, et al Frailty as a predictor of falls in older Mexican Americans J Aging Health 2012;24:641e653 16 Tom SE, Adachi JD, Anderson FA Jr, et al Frailty and ... single fallers and recurrent fallers were used as separate outcomes and data of any fallers (single fallers þ recurrent fallers) were not available, calculation of an OR of any fallers compared with ... medicine and geriatric medicine and is currently working as a general practitioner Data Sources and Search Strategy A systematic search of the literature was performed in April 2015 using Embase,...
  • 7
  • 338
  • 0
Báo cáo y học:

Báo cáo y học: " Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251" pot

Báo cáo khoa học

... (1386-5': GAAACTATGCCAAAAACAAGT and 2129-5': TAATCTAGCCTTCTGTCCTGG) and two internal gag-specific primers (1731N 5': CCGTCAGGATCAGATATTGCAGGAA and 2042C 5': CACTAGCTTGCAATCTGGGTT), as previously ... animals, the absolute number of circulating CD4+ lymphocytes, cell associated viral load and plasma vial load Results Status of animals before treatment The in vivo safety and anti-SIV efficacy ... immunophenotyping and flow cytometry (B) Cell-associated viral load was estimated in PBMCs by a quantitative PCR method based on the specific amplification of the SIV gag gene (C) Plasma viral load was estimated...
  • 11
  • 256
  • 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Nông nghiệp

... flavor and in overall flavor, and stronger in after-taste than the sample with a regular aroma concentration The heightened aroma concentration caused a slight off-flavor described as ‘artificial’ ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... a small food reward after the last evaluation session Samples The sample material was a fermented oat bran product (Yosaw, Bioferme, Finland), which is a cereal-based snack food similar to flavored...
  • 10
  • 599
  • 1
báo cáo hóa học:

báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot

Hóa học - Dầu khí

... (partial eta) [43] in a general linear model This partial correlation coefficient estimates the association between SOC and SF-36 after allowing for the associations with the demographic variables ... sex, martial status, educational level), the variable length of stay was not statistically significant for any subscale Adjusted R2 was unchanged for mental health and vitality and slightly higher ... activities such as occupational therapy and participation in the political, cultural and religious arenas In this way, health care professionals can encourage the residents to engage in activities...
  • 9
  • 844
  • 0
Paraoxonase (PON1) polymorphisms as a biomarker of susceptibility to organophosphate toxicity among a cohort of singaporean workers

Paraoxonase (PON1) polymorphisms as a biomarker of susceptibility to organophosphate toxicity among a cohort of singaporean workers

Tổng hợp

... polymorphism was amplified using forward 5´- CCT GCA ATA ATA TGA AAC AAC CTG -3´ and reverse 5- ´TGA AAG ACT TAA ACT GCC AGT C -3´ (Sardo et al 2005) Reaction mixture was 39 prepared according to ... substrate name to define PON1 activity e.g “paraoxonase” if the substrate was paraoxon, “diazoxonase” if the substrate was diazoxon and “arylesterase activity” if the substrate was phenylacetate ... study on Malays that has been done so far was from a population of Malays from Malaysia, where it was found that the L allele frequency was 0.94 and the R allele frequency 0.59 (Poh and Muniandy 2007)...
  • 130
  • 315
  • 0
Lab Linux phan I, II Installing Linux as a Server

Lab Linux phan I, II Installing Linux as a Server

Hệ điều hành

... packages có tên samba rpm –qa samba* => liệt kê packages có tên bắt đầu samba rpm –qa | grep samba => liệt kê packages có tên ch a samba rpm –qd samba => liệt kê files tài liệu liên quan đến samba ... a Cao, Q.1, TP.HCM Tel: (84-8) 38244041 – 0989012418 www.athena.edu.vn - Bạn liệt kê danh sách packages cài đặt (Installed packages) danh sách packages dùng cho bạn download (Available packages) ... (configuration) liệt kê tập tin cấu hình package 3/ Gở bỏ package (Erase): Chú ý: Nếu gỡ bỏ package mà package phụ thuộc vào package khác gỡ bỏ ta dùng thêm tuỳ chọn nodeps  Lỗi package samba-3.0.23c-2.rpm...
  • 99
  • 1,023
  • 6
Báo cáo y học:

Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"

Y học thưởng thức

... environment variables The Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure ... was stronger among men (OR=3.13) than among women (OR=2.19) (Table 2) Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase ... than days of absence per annum decreased from 2.77 to 2.68, and remained significant There was an increased risk of disability pension for people who were smokers at baseline, whereas there was...
  • 6
  • 578
  • 0
Báo cáo y học:

Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Y học thưởng thức

... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza ... infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and interactions between animals and humans become more proximate, the emergence ... pigs and humans Some of these human and avian influenza viruses might become adapted to pigs and circulate in that population The cocirculation of the viruses in swine, avian and human populations...
  • 4
  • 520
  • 0
Life as a Ghost

Life as a Ghost

Tài liệu khác

... straight away without stopping at a petrol station After having talked and talked and talked, and when I finally managed to dismiss her with fake half-promises and sat back into my car at last ... I knew it wasn’t so A more ominous explanation came to my mind Maybe everything was real, and it was taken for granted that I was dead, just I wasn’t! My brain was still working, and I would ... body Admiration and even something like awe Was he awed because she was dead, by the mystery of death? No, he was awed because in his eyes she was beautiful, a beautiful young woman… For a split...
  • 11
  • 452
  • 0
Vcd as a stimulating factor to increase the young learners’ time-on-task

Vcd as a stimulating factor to increase the young learners’ time-on-task

Thạc sĩ - Cao học

... 2005), he also makes a distinction between task-based teaching and tasksupported teaching The task-based teaching occurs when the teaching is based exclusively on meaning-focus tasks, and the task-supported ... functions and language notions are taught to learners at the same time with the assumption that language learning relates to learning formulaic expressions of language as well as learning rules of language ... segments and language teaching is aimed at helping learners learn these segments According to this view, language is seen as an object and learners as students The functional view sees language as a...
  • 45
  • 516
  • 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Tài liệu khác

... BA R = B B A where AUC is the area under the curve Statistical analysis All data are presented as a mean value with its standard deviation indicated (mean ± SD) Statistical analysis was conducted ... blank PANs (200 mg/kg); the other group was treated with a single i.v dose of normal saline All animals were fed with normal diet, and water was provided ad libitum Animals were observed carefully ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight...
  • 7
  • 391
  • 0
grey water reuse as a sustainable alternative resouree

grey water reuse as a sustainable alternative resouree

Công nghệ - Môi trường

... Piping and Conveyance, Surge/Balancing Tanks, Filters, Pump and delivery piping system A separate sanitary plumbing system has to be installed to separate the grey water from the wastewater discharges ... irrigation and also landscaping Mature Cotton plants Photo: Texas A& M University Young Tomato Plants Photo: Texas A & M University The Water Environment Research Foundation, USA carried out a study ... figures indicated that 29% (WA) and 46 %( Malaysia) of the household consumption may be safely reused without treatment with up to 40% and 70% respectively available for reuse after basic treatment...
  • 7
  • 369
  • 0
Love was as clear as a mirror

Love was as clear as a mirror

Tiếng anh

... it was her voice And it was her hand to me But it wasn’t like I thought it was “Let’s shake hands.” There we said goodbye I kept her hand in my hand, looking at her face, her smiling mouth and ... of her because of me Oh that was true, ‘cause I was a handsome teacher and I talked to people nicely But then, I realized that the truth wasn’t like that In one period, I randomly asked the students’ ... class on the last day Their fare-well party was hold in a romantic place in a big park They ate food, drank beer, sang songs, took pictures and cried I had never seen the strangest class like this,...
  • 8
  • 456
  • 0
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

Môi trường

... E2, and E5) were comparable to that in E3 as well as the natural tidal flat (C3) Also, the distribution of gastropods, polychaetes and bivalves was consistent in the artificial and natural tidal ... observed variation in the macrobenthos population in the artificial tidal flats and the natural tidal flat The abundance of macrobenthos in the artificial tidal flats increased after May 28 and finally ... chloride (PAC) as well as waste steel slag (WSS) (E5) A natural tidal flat (C3) at the same tidal level was chosen as a reference for monitoring benthic communities as well as physicochemical characteristics...
  • 13
  • 586
  • 0
Screening of PHA-Producing Bacteria Using Biodiesel- Derived Waste Glycerol as a Sole Carbon Source

Screening of PHA-Producing Bacteria Using Biodiesel- Derived Waste Glycerol as a Sole Carbon Source

Môi trường

... periodate were added Afterwards, 1.2 mL of acetylacetone solution was added and the mixture was placed in a water bath at 70ºC for An absorbance measurement was made at 410 nm against a blank sample ... volume was transferred to a clean test tube, was evaporated and then mL of concentrated sulfuric acid was added The sample was boiled for 10 minutes An absorbance measurement was made at 235 nm ... research, it can be concluded that AIK7 isolate could be a good candidate as a PHA producer by using this low-grade waste glycerol as a sole carbon source REFERENCES Anderson A J and Dawes E A...
  • 9
  • 688
  • 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Môi trường

... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... water is the same as the gas phase temperature 2.2.2 Gas diffusion layers The physics of multiple phases through a porous medium is further complicated here with phase change and the sources and ... porous gas diffusion layer and catalyst layer is described by two physical mechanisms: viscous drag and capillary pressure forces, and is described by advection within the gas channels Water transport...
  • 18
  • 549
  • 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Môi trường

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital and operating costs and minimizes degradation reactions The ... endo-glucanase, exo-glucanase and β-glucosidase Endo -and exo-glucanases are commonly referred to as “cellulases” Fungal strains of Trichoderma reesei are used to produce most commercial cellulase...
  • 20
  • 437
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25