fast die young and leave a good looking corpse code repository
Cambridge.University.Press.Learning.Medicine.How.to.Become.and.Remain.a.Good.Doctor.Jan.2008.pdf
Ngày tải lên :
21/09/2012, 10:58
... compulsory UKCAT compulsory Pre-Medical course available UKCAT compulsory UKCAT compulsory Pre-Medical course available UKCAT compulsory Graduate entry available AABb AABb AAB AAB AAB AAB AAB Hull ... Info AAA AAB AAAb AAB Dundee East Anglia Edinburgh Glasgow Guy’s, King’s AABc and St Thomas’, 370 tariff points Cardiff Acceptable on its own and combined with other qualifications Chemistry and any ... England, Wales and Northern Ireland BMAT compulsory Graduate entry and Pre-Medical course available UKCAT compulsory Graduate entry available Graduate entry available UKCAT compulsory UKCAT compulsory...
- 246
- 853
- 4
Báo cáo y học: "Dantrolene and heatstroke: a good molecule applied in an unsuitable situation" ppsx
Ngày tải lên :
12/08/2014, 20:20
... context of CHS, a disease frequently associated with hepatic failure and/ or disseminated intravascular coagulation [6] Second, there are some experimental animal studies reporting negative inotropic ... Orliaguet G, Langeron O, Coirault C, Fratea S, Coriat P, Riou B: Effects of Dantrolene on rat diaphragm muscle during postnatal maturation Anesthesiology 2001, 94:468-474 Bouchama A, Cafege A, ... management, in that both syndromes share some pathophysiological similarities: cytokine and acute-phase protein production, coagulation disorders and, finally, multiorgan dysfunction [6] Notably,...
- 2
- 212
- 0
Báo cáo khoa học: "Phrase Table Training For Precision and Recall: What Makes a Good Phrase and a Good Phrase Pair?" doc
Ngày tải lên :
08/03/2014, 01:20
... configurable features used to evaluate the quality of a phrase and a phrase pair Ideally, a perfect combination of feature functions divides the correct and incorrect candidate phrase pairs within a ... phrase translation accuracy and at the same time extract as many as possible valid phrase pairs that are missed due to incorrect word alignments One approach is to leverage underlying word alignment ... phrase pair evaluation, ranking and filtering Usually all n-grams up to a pre-defined length limit are considered as candidate phrases This is also the place where linguistic constraints can be applied,...
- 8
- 472
- 0
Minimum Wages and Employment: A Case Study of the Fast-Food Industry in New Jersey and Pennsylvania pot
Ngày tải lên :
08/03/2014, 06:20
... Bureau of National Affairs Daily Labor Report Washington, DC: Bureau of National Affairs, May 1990 Labor Relations Reporter Wages and Hours Manual Washington, DC: Bureau of National Affairs, ... employment at fast- food restaurants in February and March than in November and December An analysis of national employment data for food preparation and service workers, however, shows higher average ... e sample consists of 357 stores with available data o n employment and starting wages in waves and T h e dependent variable in all models is change in F T E employment T h e mean and standard...
- 26
- 869
- 0
Money and happiness a guide to living the good life
Ngày tải lên :
12/03/2014, 14:51
... nongraduates I have an associate degree People with an associate degree earned an average of $33,000 in 2000 I have a bachelor’s degree About one in four Americans ages 25 and older has attained a bachelor’s ... 2002, meaning they lack the means to ensure themselves of healthy meals and are vulnerable to at least a mild form of chronic malnutrition.3 WEALTH AND VALUES I live in a home that has heat and running ... following wealth assessment to get some perspective on where you stand: WEALTH AND VALUES Yes I have easy access to food and clean water I live in a home that has heat and running water I feel safe in...
- 258
- 358
- 0
For Young Women Only by Shaunti Feldhahn and Lisa A. Rice potx
Ngày tải lên :
14/03/2014, 18:20
... Hannah—beautiful daughters and delightful friends, and Brandon a great young man in training From Shaunti: To a wonderful young lady and little laddie, who in a few short years will grow into a strong and ... tons of research and data gathering about men that no one had done before Turns out, her Harvard graduate degree and years as a Wall Street analyst helped pave the way for these well-researched books! ... TV and radio, and Shaunti has had speaking engagements about it all across the country People started asking Shaunti for a follow-up book that would teach the same concepts, but in a way that...
- 35
- 320
- 0
A GOOD PRACTICE GUIDE SUSTAINABLE FOREST MANAGEMENT, BIODIVERSITY AND LIVELIHOODS ppt
Ngày tải lên :
23/03/2014, 23:21
... defined as “an area of land and/ or sea especially dedicated to the protection and maintenance of biological diversity, and of natural and associated cultural resources, and managed through legal or ... belief that it helps communicate the value of Sustainable Forest Management as a reliable framework for safeguarding and delivering a broad range of goods and services, in a fair and equitable manner, ... strategies This is unfortunate, as NFTPs and forest services such as medicinal and food plants, clean water, rattan, bushmeat and bamboo play an important role in rural livelihoods and local and...
- 53
- 326
- 0
BUILDING A GOOD AND EFFECTIVE LOGO: Short Introduction
Ngày tải lên :
30/05/2014, 21:29
... work across a variety of mediums and applications VECTOR FORMAT is master It ensures that the logo can be scaled to any size A good logo should be able to work both in horizontal and vertical formats ... I AM SINCE : 1968 OCCUPATION : CREATIVE ON AN ADVERTISING AGENCY EDUCATION : HE DUTCH ACADEMY OF ART AND DESIGN T RIETVELD ACADEMIE AMSTERDAM PHILOSOPHY : EVERYTHING IS A CHANCE THINKS : REALITY ... imitates a small child’s backward writing of “R” which is short for “are” , One big advantage of a good name “that say’s it all”: you don’t need any long and incomprehensible mission statements...
- 26
- 233
- 1
Báo cáo hóa học: " Research Article Novel VLSI Algorithm and Architecture with Good Quantization Properties for a " docx
Ngày tải lên :
21/06/2014, 07:20
... This approach leads to low I/O cost and reduced hardware complexity, high speed and a regular and modular hardware structure Systolic arrays are an appropriate architectural paradigm that leads ... arrays having the same form and length and using a small number of I/O channels placed at the two extreme ends of the array The proposed systolic algorithm uses an appropriate parallelization method ... where we not have such a parallelization Moreover, due to the fact that the two equations have a similar form and the same length, they can be mapped on the same linear systolic array with the...
- 14
- 331
- 0
Báo cáo hóa học: " Research Article A Two-Layered Mobility Architecture Using Fast Mobile IPv6 and Session Initiation Protocol" pot
Ngày tải lên :
22/06/2014, 19:20
... realtime applications, it is necessary to decrease delays and packet loss as much as possible, and the integrated scheme aims at EURASIP Journal on Wireless Communications and Networking Home agent ... signaling latency Each data point on all graphs shown below corresponds to an average of 20 independent handover simulation events The handover-associated signaling latency is measured against ... shows that range has marginal effect on handover latency in both schemes and therefore, no significant change in handover latency was observed On a small-scale network, WLAN configurations not a ect...
- 8
- 296
- 0
ARBITRATION – A GOOD CHOICE FOR DISPUTES WITH ECONOMIC AND COMMERCIAL NATURE
Ngày tải lên :
23/06/2014, 09:15
... Kennen, Advantages and Disadvantages of ADR - Understanding Alternative Dispute Resolution (2008), available at http://www.suite101.com/content/advantages -and- disadvantages-of-adr -a5 8925 Garry ... enforcement of an international arbitral award is far easier and more certain than that of a foreign court judgment41 In brief, arbitration guarantees its parties to reach a final and binding award, which ... neutral and adjustable to be more appropriate for each kind of dispute Those advantages can hardly found in litigation at court ENFORCEMENT OF ARBITRAL AWARD Another significant advantage of arbitration...
- 15
- 1.5K
- 1
How to be a good steward of energy and the environment potx
Ngày tải lên :
29/06/2014, 04:20
... here are some average annual household expenditures: $1,764 What Is Cap and Trade? Under a cap -and- trade program, each power plant, factory, refinery, and other regulated entity would be allocated ... schemes are as simple as placing a tax on carbon emissions, while others, such as “cap and dividend” or “cap and invest,” are really variations of the original Take cap and dividend Under this plan, ... pipelines and Alaskan Drilling: Small Area, Big Potential Alaska ANWR CANADA This circle is the size of This circle is the size The the entire Arctic National of Alaska Arctic Wildlife Refuge, or ANWR...
- 15
- 462
- 0
Báo cáo nghiên cứu khoa học: " BUILDING A GOOD IMAGE FROM TWO COLOR IMAGES OF CAMERA MODEL USING GA AND DISCRETE WAVELET TRANSFORM" pptx
Ngày tải lên :
22/07/2014, 02:21
... Histogram and standard deviation comparisons (a) , (c), (e) are histograms and standard deviation corresponding to R, G, B color of image 9a; (b), (d), (f) are histograms and standard deviation ... Histogram and standard deviation comparisons (a) , (c), (e) are histograms and standard deviation corresponding to R, G, B color of image 9b; (b), (d), (f) are histograms and standard deviation ... perform the analysis and synthesis on each color separately to build a good color image Fig and are two red color images perceived from two original color image 4a and 4b After passing these images...
- 10
- 297
- 0
Region-specific effects on brain metabolites of hypoxia and hyperoxia overlaid on cerebral ischemia in young and old rats: a quantitative proton magnetic resonance spectroscopy stud pot
Ngày tải lên :
10/08/2014, 05:21
... conceivable that ischemia-hyperoxia is a milder disturbance than ischemia-hypoxia, inasmuch as the former did not cause any changes in the hippocampal NAA concentration, at least as revealed by ... the analysis and interpretation of data and was involved in writing the manuscript and revising it critically for scientific content All authors read and approved the final manuscript 14 Acknowledgements ... (2H) Page of Statistical analysis Two-way ANOVA was used to test the effects of age, treatment (ischemia-hypoxia and ischemia-hyperoxia) or age × treatment, for each metabolite in the three brain...
- 9
- 285
- 0
Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc
Ngày tải lên :
10/08/2014, 05:21
... for A5 9V, A5 9V-R (5’-CCTCAAAGTTCTCAGTAACGTCACCTCCAGCTTG-3’) and A5 9V-F (5’-CAA GCTGGAGGTGACGTTACTGAGAACTTTGAGG-3’); for A5 9 S, A5 9S-R (5’-CAAGCTGGAGGTGACTCTACTGAGAACTTTGAGG-3’) and A5 9S-F (5’-CA ... (5’CCAGCTTGTTCCCTGATAACTTCTTCCCCACC-3’) and L51I-F (5’-GGTGGGGAAGAAGTTATCAGGGAACAAGCTGG-3’); for L51T, L51T-R (5’-CCAGCTT GTTCCCTTGTAACTTCTTCCCCACC-3’) and L51T-F (5’-GGTGGGGAAGAAGTTACAAGGGAACAAGCT ... (5’-CA AGCTGGAGGTGACTCTACTGAGAACTTTGAGG3’); for G6 7A, G6 7A- R(5’-GGCATCTGTAGAGTGCGCGACATCCTCAAAGTTC-3’) and G6 7A- F (5’-GAAC TTTGAGGATGTCGCGCACTCTACAGATGCC-3’); and for G67 S, G67S-R (5’-GGCATCTGTAGAGTGCGAGACATCCTCAAAGTTC-3’)...
- 15
- 477
- 0
Báo cáo y học: " Correction: Frequency, course and correlates of alcohol use from adolescence to young adulthood in a Swiss community survey" ppt
Ngày tải lên :
11/08/2014, 16:22
... manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance ... Steinhausen et al BMC Psychiatry 2010, 10:15 http://www.biomedcentral.com/1471-244X/10/15 Page of Correction After the publication in this journal [1] we became aware of the fact that the article ... doi:10.1186/1471-244X-10-15 Cite this article as: Steinhausen et al.: Correction: Frequency, course and correlates of alcohol use from adolescence to young adulthood in a Swiss community survey BMC Psychiatry 2010 10:15...
- 2
- 279
- 0
Báo cáo y học: " Severe thrombocytosis and anemia associated with celiac disease in a young female patient: a case report" pdf
Ngày tải lên :
11/08/2014, 23:21
... Finally, the patient was diagnosed with celiac disease by small bowel biopsy As summarized by Halfdanarson et al [3], anemia and/ or thrombocytosis may occur as clinical manifestations of celiac ... usually made through small bowel biopsies and testing for anti-endomysial or anti-tissue-transglutaminase antibodies [3] Case presentation In November 2006 a 25-year-old Palestinian woman was admitted ... saturation was 0.4% (normal range 16.0–45%) Lactate dehydrogenase was slightly elevated at 4.75 µmol/l (normal values below 4.12 µmol/l), folic acid was in the normal range and vitamin B12 was slightly...
- 5
- 395
- 0
Báo cáo y học: "Cystic fibrosis presenting as recurrent pancreatitis in a young child with a normal sweat test and pancreas divisum: a case report" pps
Ngày tải lên :
11/08/2014, 23:21
... rest and hydration, and was ultimately discharged on a low fat diet once her serum amylase and lipase normalized Her previous investigations included a normal sweat chloride test and a normal endoscopic ... of patients are able to digest and absorb fat normally, and as a consequence are at risk for recurrent pancreatitis In this unique patient population, pancreatitis is frequently the clinical presentation ... patients are typically diagnosed with CF later in childhood, as the cases are clinically less severe and usually lack sinopulmonary disease Pancreatitis is a rare manifestation of cystic fibrosis, affecting...
- 4
- 334
- 0
Báo cáo y học: "Turning up the volume on mutational pressure: Is more of a good thing always better? (A case study of HIV-1 Vif and APOBEC3)" pot
Ngày tải lên :
13/08/2014, 06:20
... Wildtype Codon APOBEC3G Target APOBEC3F Target ATG(G) GAC CAG(G) ATG(G) TTG (A) GAG (A) GGA ATG(G) + + + + + Observed Mutant Codon Mutant Frequency ATA na CAA× ATA* TTA× AAG* AGA ATA 0.7 0.5 0.6 0.1 0.3 ... reports demonstrate that APOBEC3G is catalytically active and has antiviral potency as a monomer The monomeric capacity of APOBEC3G makes the range of 3–11 molecules per virion meaningful, and likely ... Pochet S, Chester A, Navaratnam N, Wain-Hobson S, Vartanian JP: APOBEC3G is a single-stranded DNA cytidine deaminase and functions independently of HIV reverse transcriptase Nucleic Acids Res 2004,...
- 8
- 383
- 0