family feeling useless a scandal in parliament a scandal at home war
Prevention of falls in the elderly living at home pdf
Ngày tải lên :
14/03/2014, 17:20
... person’s attitude toward the risk taking behavior Inappropriate eyewear Vision plays an important role in maintaining balance Low vision and certain vision diseases can provoke falls (see “Balance and ... mechanism of falls and how the interact Literature data are sometimes ambiguous for certain risk factors The association between falls and intrinsic factors, particularly gait and balance, has ... citations for this definition are taken from the Plan national d’éducation pour la santé (“National health education plan”) (Ministry of Solidarity and Employment and State Secretariat for Health...
- 155
- 1.4K
- 1
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"
Ngày tải lên :
25/10/2012, 11:40
... Federation notation), as well as with the presence of an impacted supernumerary tooth (distomolar 4.9) The patient reported localized pain and a slight homolateral submandibular lymphadenopathy, ... such as cleidocranial dysplasia and Gardner’s syndrome 23 However, multiple supernumerary teeth in non-syndromic patients is a rare condition 25 After a careful examination of the international ... stained bands - the dark regions tend to be heterochromatic, late-replicating and AT rich The light regions tend to be euchromatic, early-replicating and GC rich The most frequent complication...
- 7
- 597
- 0
Báo cáo hóa học: " Research Article Convergence of Iterative Sequences for Common Zero Points of a Family of m-Accretive Mappings in Banach Spaces" pdf
Ngày tải lên :
21/06/2014, 05:20
... mappings,” International Journal of Mathematics and Mathematical Sciences, vol 24, no 3, pp 173–177, 2000 16 M Maiti and B Saha, “Approximating fixed points of nonexpansive and generalized nonexpansive ... 2009 19 X Qin and Y Su, “Approximation of a zero point of accretive operator in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 329, no 1, pp 415–424, 2007 20 Y Yao and Y.-C ... variational inequality x∈F T , such that I − f x, x − x ≤ 0, ∀x ∈ F T 1.11 Recall that a possibly multivalued operator A with domain D A and range R A in E is accretive if for each xi ∈ D A and...
- 12
- 326
- 0
báo cáo hóa học:" Research Article Strong Convergence Theorems of a New General Iterative Process with Meir-Keeler Contractions for a Countable Family of λi -Strict Pseudocontractions in q-Uniformly Smooth Banach Spaces" pptx
Ngày tải lên :
21/06/2014, 11:20
... application aux e’quations inte’grales,” Fundamenta Mathematicae, vol 3, pp 133–181, 1922 A Meir and E Keeler, A theorem on contraction mappings,” Journal of Mathematical Analysis and Applications, ... points of nonlinear mappings in Hilbert space,” Journal of Mathematical Analysis and Applications, vol 20, pp 197–228, 1967 S Banach, “Surles ope’rations dans les ensembles abstraits et leur application ... if a space satisfies Opial’s condition and has a uniformly Gˆ teaux differentiable norm, then it has a weakly continuous duality mapping a We already know that in q-uniformly smooth Banach space,...
- 19
- 341
- 0
báo cáo hóa học:" Research Article Strong Convergence Theorems of Viscosity Iterative Methods for a Countable Family of Strict Pseudo-contractions in Banach Spaces" pot
Ngày tải lên :
21/06/2014, 11:20
... American Mathematical Society, vol 73, pp 957–961, 1967 K Aoyama, Y Kimura, W Takahashi, and M Toyoda, “Approximation of common fixed points of a countable family of nonexpansive mappings in a Banach ... reflexive Banach space E with a weakly continuous duality a mapping Other investigations of approximating common fixed points for a countable family of nonexpansive mappings can be found in 3, 5–10 and ... Point Theory and Applications, vol 2009, Article ID 369215, 23 pages, 2009 11 L.-G Hu and J.-P Wang, “Mann iteration of weak convergence theorems in Banach space,” Acta Mathematicae Applicatae...
- 21
- 379
- 0
Báo cáo hóa học: "Research Article A Strong Convergence Theorem for a Family of Quasi-φ-Nonexpansive Mappings in a Banach Space" pdf
Ngày tải lên :
22/06/2014, 11:20
... Reich, “An iterative method for solving a class of nonlinear operator equations in Banach spaces,” Panamerican Mathematical Journal, vol 4, no 2, pp 39–54, 1994 12 S Kamimura and W Takahashi, “Strong ... Netherlands, 1990 W Takahashi, Nonlinear Functional Analysis, Yokohama Publishers, Yokohama, Japan, 2000 10 Ya I Alber, “Metric and generalized projection operators in Banach spaces: properties and ... proof Acknowledgment This work was supported by the National Natural Science Foundation of China under Grant 10771050 References Y Haugazeau, Sur les in quations variationnelles et la minimisation...
- 12
- 221
- 0
Báo cáo hóa học: "Research Article Block Iterative Methods for a Finite Family of Relatively Nonexpansive Mappings in Banach Spaces" docx
Ngày tải lên :
22/06/2014, 22:20
... and W Takahashi, “Approximating fixed points of nonexpansive mappings by the block iterative method in Banach spaces,” International Journal of Computational and Numerical Analysis and Applications, ... method and applications,” in Nonlinear Analysis and Convex Analysis, W Takahashi and T Tanaka, Eds., pp 305–313, Yokohama Publishers, Yokohama, Japan, 2004 [14] S Matsushita and W Takahashi, A strong ... Information Environment, Tokyo Denki University, Muzai Gakuendai, Inzai 270-1382, Chiba, Japan Email address: kohsaka@sie.dendai.ac.jp Wataru Takahashi: Department of Mathematical and Computing...
- 18
- 235
- 0
Báo cáo hóa học: " ITERATIVE SCHEMES WITH SOME CONTROL CONDITIONS FOR A FAMILY OF FINITE NONEXPANSIVE MAPPINGS IN BANACH SPACES" docx
Ngày tải lên :
23/06/2014, 00:20
... operators in Banach spaces, J Math Anal Appl 75 (1980), no 1, 287–292 , Approximating fixed points of nonexpansive mappings, Panamer Math J (1994), no 2, 23–28 T Shimizu and W Takahashi, Strong ... 604-714, Korea E-mail address: jungjs@mail.donga.ac.kr Yeol Je Cho: Department of Mathematics Education, College of Education, and the Research Institute of Natural Science, Gyeongsang National University, ... nonexpansive mappings in Banach spaces, Bull Korean Math Soc 34 (1997), no 1, 93–102 J S Jung and C H Morales, The Mann process for perturbed m-accretive operators in Banach spaces, Nonlinear Anal...
- 11
- 305
- 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps
Ngày tải lên :
09/08/2014, 14:20
... MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue ... MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: ... MICA-25 0A in our data As there are many links between the innate and adaptive immune systems and involvement of pathogens in the initiation of RA is discussed (reviewed by Falgarone and colleagues...
- 11
- 460
- 0
A study of the issues of teaching listening setions in tiếng anh 11 at high schools in nghe an
Ngày tải lên :
14/12/2013, 00:41
... that should be taken into careful consideration such as problems in linguistic features, problems in retrieving information, problems in catching the main information and problems in note-taking ... teaching in Tieng Anh 11 Finally, class observations are very important to examine the current teaching context in each listening lesson The data was tape-recorded and transcripted 3.6 DATA ANALYSIS ... questionnaires, interviews and class observations Clarifying the data into intended groups Doing statistical calculation Describing the collected data presented in tables and figures Generalizing and...
- 140
- 838
- 5
A study on communicatve activities for non anglish majors in english grammar classes at vinh medical university
Ngày tải lên :
18/12/2013, 10:03
... communicative activities in English grammar classes - Investigating and analyzing the results gained from the survey about the current situation of teaching and learning English grammar at VMU and analyzing ... remember grammar rules very well, they cannot communicate in the target language and apply them in the writing smoothly at all As a result, there has been great innovation in teaching and learning English ... talk about an explicit approach to grammar we are talking about starting directly, usually at the beginning of a particular activity, what the grammar is On the other hand, an implicit approach...
- 86
- 699
- 2
A study on second year student's difficulties in reading esp materials at automobile technology departement in vietnam korea technical college
Ngày tải lên :
18/12/2013, 10:03
... - transferring or using the information while or after reading 2.4.4 ESP reading materials Materials play an important role in teaching and learning process, especially in teaching ESP reading ... Arranging and planning your learning - Evaluating your learning Affective strategies: - Lowering your anxiety - Encouraging yourself - Taking your emotional temperature Social strategies: - Asking ... a language problem Bernhard and Kamil (1995:17) assumesd that “reading performance in a second language is largely shared with reading ability in a first language” In the late 1980s, Gissi Sarig...
- 101
- 636
- 0
Tài liệu A Look at…Third Grade in California Public Schools doc
Ngày tải lên :
14/02/2014, 09:20
... details, speaking clearly at an understandable pace a Plan and deliver an informative/explanatory presentation on a topic that: organizes ideas around major points of information, follows a logical ... mathematics as a language However, the academic language of mathematics instruction and the specialized vocabulary of mathematics can create particular challenges for English learners The language ... recount an experience with appropriate facts and relevant, descriptive details, speaking clearly at an understandable pace a Plan and deliver an informative/explanatory presentation on a topic that:...
- 88
- 529
- 0
Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc
Ngày tải lên :
21/02/2014, 09:20
... counterexample, nor ever gainsay that particular mathematical fact It should not be thought that the generation of mathematical proofs is mechanical Far from it A mathematician discovers ideas intuitively—just ... a Ph.D in mathemat16 There is a grand tradition in mathematics of not leaving a trail of corn so that the reader may determine how the mathematical material was discovered or developed Instead, ... Death of Proof? [HOR1] In it he declared that traditional mathematical proofs no longer had any role in our thinking A part, but not all, of Horgan’s message was that any question that mathematicians...
- 334
- 515
- 0
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
Ngày tải lên :
08/03/2014, 08:20
... facilitates degradation of starch granules by the enzymes containing such a domain Throughout this paper, domain E is referred to as SBD, the starch-binding domain In a classification of carbohydrate-binding ... evolutionary trees calculated for individual domains also reveals that a transition occurs in parts of the proteins which are C-terminal to domain A, discriminating the various GH 13 hydrolases from ... Carbohydrate-active enzymes: an integrated database approach In Recent Advances in Carbohydrate Bioengineering (Gilbert, H.J., Davies, G., Henrissat, B & Svensson, B., eds), pp 3–12 The Royal...
- 11
- 615
- 0
Báo cáo khoa học: Substrate recognition by three family 13 yeast a-glucosidases Evaluation of deoxygenated and conformationally biased isomaltosides pptx
Ngày tải lên :
23/03/2014, 21:21
... ring in transition-state stabilization While the invariant Asp plays a role in catalysis [47] and mutation leads to inactivation, the single mutation to Asn of each of two His interacting at subsite ... transition-state stabilizing histidines, and structurally important arginine and aspartate side chains [30] While protein±substrate contacts at subsite )1 provide major binding energy, the distribution and ... structures along the reaction pathway of cyclodextrin glycosyltransferase elucidate catalysis in the a- amylase family Nat Struct Biol 6, 432±436 van der Veen, B., Uitdehaag, J.C.M., Penninga, D., van Alebeek,...
- 7
- 374
- 0
War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? docx
Ngày tải lên :
29/03/2014, 03:20
... official title of “To authorize the issuance of United States War Bonds to aid in funding of the operations in Iraq and Afghanistan.” All three bills are similar and state that the authorized war ... accrue earnings based on both a fixed rate of return and a semiannual inflation rate A single, annual rate, called the composite rate, reflects the combined effects of the fixed rate and the semiannual ... War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? Summary The high costs of fighting the wars in Iraq and Afghanistan have rekindled congressional interest in...
- 7
- 361
- 0
MOTIVATONAL FACTORS AS PREDICTORS OF TEACHERS’ JOB PERFORMANCE IN COLLEGES OF EDUCATION AT NORTHERN PROVINCES: A PROPOSED ENHANCEMENT PROGRAM
Ngày tải lên :
13/05/2014, 15:23
... can be defined as the dynamically changing cumulative arousal in a person that initiates, directs, coordinates, amplifies, terminates, and evaluates the cognitive and motor processes whereby initial ... education in Northern Province of Vietnam are not well motivated in teaching which means that the quality of education is just moderate The main factors may be alleviated to the quality of teaching ... educators However, recent reports in educational journals and in the popular press about teachers’ stress and burnout indicate that teachers’ job satisfaction and morale merit has increased attention...
- 149
- 224
- 0
báo cáo sinh học:" Health workforce attrition in the public sector in Kenya: a look at the reasons" ppt
Ngày tải lên :
18/06/2014, 17:20
... laboratory technicians and laboratory technologists in a category that we call "laboratory staff", and we group pharmacists and pharmaceutical technologists in a category that we call "pharmacy ... abounds, most countries have weak human resource information systems (HRIS) that cannot provide adequate data on the rates of health worker attrition One way to obtain empirical data on HRH attrition, ... and overwhelming workload and stress induced by caring for, and seeing high death rates among, HIV/AIDS patients [4] For health workers in rural areas, an additional problem is inadequate quality...
- 8
- 494
- 0