explain the regulatory requirements of a sales role

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Ngày tải lên : 16/02/2014, 09:20
... December 2009) doi:10.1111/j.1742-4658.2010.07559.x The extracellular phytase of the plant-associated Klebsiella sp. ASR1 is a member of the histidine-acid-phosphatase family and acts primarily as a scavenger of phosphate groups locked in the ... substrate-free AppA the C a atoms are 2.41 A ˚ apart, whereas for the substrate-free PhyK and the substrate-loaded AppA the averaged distance is only 1.87 A ˚ . Distinct conformational changes were observed ... con- served active-site motifs, RHGXRXP and HD, and hydrolyze metal-free phytate with pH optima in the acidic range. They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic...
  • 13
  • 766
  • 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Ngày tải lên : 21/02/2014, 15:20
... quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424; AD**, pACT2. Activity values are given as mean values ± standard ... PCR- amplified from the DNA of the cosmid clone #9 [18] using the following pair of primers: 5Â-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3Â and 5Â-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3Â.Tomakethe b-galactosidase expressing ... the cDNA #911 using the following pair of primers: 5Â-CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3Â and 5Â-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3Â. BamHIPstI digested PCR product was cloned as a fusion...
  • 10
  • 464
  • 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Ngày tải lên : 07/03/2014, 14:20
... glycosyl- transferase elucidate catalysis in the alpha-amylase family. Nat. Struct. Biol. 6, 432–436. 16. Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai, A. , Henrissat, B. & Dijkstra, ... However, the mechanistic roles of several of these residues are not described well and there is no example of mutational analysis of all of these residues in the same enzyme. To obtain an insight ... regard to the role of Asp140, whichappearstobecrucialinChiBandinchitinaseA1 from Bacillus circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases...
  • 10
  • 651
  • 0
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

Ngày tải lên : 27/10/2012, 16:51
... The Marketing Strategy of a multinational join stock company multinational join stock company has a certain advantage: a multinational join stock company has always kept its prices as competitive ... department is in charge of marketing plans on importing, material providing and preceding the contracts. Organizing the sales of products is another main task of the department. ã Financial and ... stock company size and market share have been small. The shortage of capital is main cause of the company’s modest size and market share. Up to now, a multinational join stock company has had only...
  • 25
  • 623
  • 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Ngày tải lên : 24/12/2013, 01:17
... in the child DataTable. This is the default. None Indicates that no action takes place. SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the ... you change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable. ... UpdateRule is set to None. ã The CommandText of the Command object in the UpdateCommand of the DataAdapter is the same as in the second case. The following code sets the UpdateRule of the...
  • 6
  • 428
  • 0
Tài liệu Báo cáo khoa học: Crystal structures of the regulatory subunit of Thr-sensitive aspartate kinase fromThermus thermophilus pdf

Tài liệu Báo cáo khoa học: Crystal structures of the regulatory subunit of Thr-sensitive aspartate kinase fromThermus thermophilus pdf

Ngày tải lên : 18/02/2014, 08:20
... that chimeric AK, BTT, which is composed of the catalytic domain of BsAKII and the regulatory domain and b-subunit of TtAK, had thermostability as high as that of wild-type TtAK, suggesting that ... differential scanning calorimetry; EcAKIII, aspartate kinase III from Escherichia coli; MAD, multiwavelength anomalous diffraction; MjAK, aspartate kinase from Methanococcus jannaschii; TtAK, aspartate kinase ... catalytic domain from BsAKII and regulatory domains (a regulatory domain in the a- subunit, and a b-subunit with the same sequence as the regulatory domain) from TtAK, improved thermostability as much as wild-type...
  • 13
  • 785
  • 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Ngày tải lên : 19/02/2014, 16:20
... o AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus 119 119 119 119 119 120 119 121 118 119 159 159 159 159 157 158 157 160 158 159 199 199 199 199 197 198 197 200 198 199 VI ... (Fig. 1A) , and that of chloroplast spinach GAPDH [35] w ere examined t o AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus AthalianaB PativumB SoleraceaB NtabacumB A. thalianaA PsativumA SoleraceaA Chlamy Synechocystis Synechococcus 119 119 119 119 119 120 119 121 118 119 159 159 159 159 157 158 157 160 158 159 199 199 199 199 197 198 197 200 198 199 VI ... R A R A A A L N I V P T S T G A A K A VAL V L PNL K G K L N G I A L R V P R R A R A A A L N I V P T S T G A A K A VAL V L PTL K G K L N G I A L R V P R R A R A ACL N I V P T S T G A A K A VAL...
  • 8
  • 494
  • 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Ngày tải lên : 19/02/2014, 19:20
... link the senses across dictionaries, hence Wik is only used as augmented data for WMF to better learn the semantics of words. All data is tokenized, POS tagged (Toutanova et al., 2003) and lemmatized, ... this case, many senses will share the same latent semantics profile, as long as they are in the same topic/domain. To solve the sparsity issue we use missing words as negative evidence of latent ... (adjectives and adverbs) do not have a taxonomic representation structure. For example, the jcn similarity measure (Jiang and Conrath, 1997) computes the sense pair similarity score based on the information...
  • 5
  • 585
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Ngày tải lên : 21/02/2014, 01:21
... Peplow, F. Yamakura and T. Matsumoto for the analyses of iron and manganese in protein samples. We also wish to thank H. Steinman for the gift of E. coli OX32 6A. We finally thank Mr M. Farrugia for ... helper phage (Stratagene). One microgram was utilized in mutagenesis reactions together with oligonucleo- tides ECF-Q69G d(5Â-AACAACGCAGCT GGGCTCTG GAACCAT), ECF -A1 41Q d(5Â-TCAACCTCTAAC CAG GCTACTCCGCTG) ... d(5Â-AACAACGCTGG C CAGCACGCTAACCAC) and ECM-Q14 6A d(5Â-TCT ACTGCTAAC GCGGATTCTCCGCTG) following the manufacturers instructions (mutagenic nucleotide are underlined). Mutated plasmids were designated...
  • 12
  • 740
  • 0
Báo cáo khoa học: Neural retina leucine-zipper regulates the expression of Ppp2r5c, the regulatory subunit of protein phosphatase 2A, in photoreceptor development pdf

Báo cáo khoa học: Neural retina leucine-zipper regulates the expression of Ppp2r5c, the regulatory subunit of protein phosphatase 2A, in photoreceptor development pdf

Ngày tải lên : 06/03/2014, 02:20
... 5Â-AAA AAA AAG ACA AAC TGA-3Â; Ppp2r5c promoter (DNRE), forward, 5Â-TAG CAC TTC CTG ACT ATT-3Â; Ppp2r5c promoter (DNRE), reverse, 5Â-GAA GCT GCA ACT TAA AAT-3Â; Ppp2r5c promoter (NRE), forward, ... GC-3Â and 5Â-GCC AGA GGC TGA TTC AGC ATC CGC GAG AT-3Â; oli- gonucleotides for the Ppp2r5c promoter, 5Â-CCC TGA AGC CAG GAT GAG CCG CAG GGA AAG-3Â and 5Â-TGG AGC TC G CTG ATT GGC CAG AAG CTG CAA- 3Â) ... 15267–15276. 13 Tanabe O, Nagase T, Murakami T, Nozaki H, Usui H, Nishito Y, Hayashi H, Kagamiyama H & Takeda M (1996) Molecular cloning of a 74-kDa regulatory sub- unit (BÂÂ or delta) of human protein...
  • 10
  • 378
  • 0
THE REGULATORY STATUS OF BROADBAND SERV- ICES: INFORMATION SERVICES, COMMON CAR- RIAGE, OR SOMETHING IN BETWEEN? docx

THE REGULATORY STATUS OF BROADBAND SERV- ICES: INFORMATION SERVICES, COMMON CAR- RIAGE, OR SOMETHING IN BETWEEN? docx

Ngày tải lên : 07/03/2014, 11:20
... ideas today. Through all the technical discussions, all that technical FCC and PUCA rigmarole, if we can just all agree that in a broadband world it is all the same and Americans ought to have access ... regulatory treatment of cable and wire-line broadband services are around the corner. The FCC has already ruled that the cable broadband falls under Title I rather than Title II. Absent another ... and the regulatory approach is fundamen- tally grounded in a wireline paradigm. In the regulated market, for example, LATA boundaries matter. In the unregulated market, they do not. The regulated...
  • 141
  • 369
  • 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Ngày tải lên : 08/03/2014, 02:21
... structure of an HHMM The models discussed here are evaluated by applying them to natural language tasks based on CoNLL-2004 1 and a sub-corpus of the Lancaster Treebank 2 . Keywords: information extraction, ... Grammar Parsing Creation of a parse tree involves describing lan- guage grammar in a tree representation, where each path of the tree represents a grammar rule. Consider a sentence from the Lancaster ... 6: The graph of micro-average F -measure against the number of training sentences during text chunking (A: MHHMM, B: HHMM and C: HMM) The first finding is that the size of training data dramatically...
  • 8
  • 528
  • 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Ngày tải lên : 08/03/2014, 09:20
... and barley a- amylases are thus also presented. MATERIALS AND METHODS SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured ... PPA, an a- amylase studied by us earlier. Also an attempt has been made to use this program for subsite mapping of other a- amylases found in the literature. Evaluations of subsite maps of rice and ... Mapping of a- Amylases) is freely available for research and educational purposes via the Internet (E-mail: gyemant@tigris.klte.hu). The advantages of this program are demonstrated through a- amylases...
  • 6
  • 387
  • 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Ngày tải lên : 08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K. & Yonehara, S. (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX. Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... C-terminal region is rich in acidic amino acids, if it does have some interaction with the N-terminal domain, the mechanism of regulating the catalytic activity may be similar to that of the dimer....
  • 9
  • 533
  • 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt

Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt

Ngày tải lên : 08/03/2014, 22:20
... the reaction mechanism of a bacterial ATP-citrate lyase Tadayoshi Kanao, Toshiaki Fukui, Haruyuki Atomi and Tadayuki Imanaka Department of Synthetic Chemistry and Biological Chemistry, Graduate ... products, AclA (a subunit) and AclB (b subunit). By comparing the primary structures of AclA and AclB with that of the mammalian enzyme, we found that AclA and AclB Correspondence to T. Imanaka, Department ... reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, and the cleavage of the resulting citryl-CoA to acetyl-CoA and oxaloacetate....
  • 8
  • 551
  • 0