example of algorithm for calculating the hemodilution of a donor having received blood blood components or plasma volume expanders within 48 hours prior to death

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC...
  • 11
  • 679
  • 0
Báo cáo nghiên cứu khoa học: "COMPUTE AND DEFINE EXACTLY THE REGION OF ELASTIC REACTION FORCE FOR CALCULATING THE SECTION FORCE OF UNDERGROUND CONSTRUCTION BY FINITE ELEMENT METHOD" pptx

Báo cáo nghiên cứu khoa học: "COMPUTE AND DEFINE EXACTLY THE REGION OF ELASTIC REACTION FORCE FOR CALCULATING THE SECTION FORCE OF UNDERGROUND CONSTRUCTION BY FINITE ELEMENT METHOD" pptx

Ngày tải lên : 22/07/2014, 03:20
... around the acceptable region for standard calculation ϕ = π Therefore, with the experiment formula, we have the experience value of the effected region by the elastic reaction force ϕ = π to calculate ... of element When making the calculation we have to transform this matrix to the global coordinate Figure presents the cant bar element with any angle β of horizontal axis x Displacement is presented ... 3 .THE STIFFNESS MATRIX OF THE BEAM ON THE ELASTIC FOUNDATION IN THE SYSTEM OF THE GLOBAL CO-ORDINATE In the above part, we presented the stiffness matrix with the system of local co-ordinate of...
  • 10
  • 328
  • 0
báo cáo hóa học: " Population norms and cut-off-points for suboptimal health related quality of life in two generic measures for adolescents: the Spanish VSP-A and KINDL-R" pdf

báo cáo hóa học: " Population norms and cut-off-points for suboptimal health related quality of life in two generic measures for adolescents: the Spanish VSP-A and KINDL-R" pdf

Ngày tải lên : 18/06/2014, 18:20
... KINDL-R, a global score close to 70.0 was related to a SE value of 0.70 to 0.73, for the screening of a probable mental or psychosocial health problem and a SP associated value between 0.70 and 0.63, ... the fieldwork and Alejandro Lorenzo who is a bio-medical translator for his revision of the English grammar and style Finally, the authors acknowledge the comments and suggestions of anonymous ... explain the clinical significance of health status measures Mayo Clin Proc 2002, 77(4):371-383 Achenbach TM, Rescorla LA: Manual for the ASEBA school-Age forms & profiles An integrated system of multi-informant...
  • 9
  • 557
  • 0
Báo cáo hóa học: " Research Article A Scheduling Algorithm for Minimizing the Packet Error Probability in Clusterized TDMA Networks" pptx

Báo cáo hóa học: " Research Article A Scheduling Algorithm for Minimizing the Packet Error Probability in Clusterized TDMA Networks" pptx

Ngày tải lên : 21/06/2014, 22:20
... obtained primal solution is found to be unsatisfactory, then the dual variables are updated, and we iterate again Hence, for a given vector of dual variables µ, this problem is a two-dimensional ... a tractable analytical solution for the PER for a wide range of different modulations, coding methods, and fading channels [11] To overcome this, a closed-form formula for estimation of the PER ... and Network Algorithms, SIAM, Philadelphia, Pa, USA, 1983 D P Bertsekas, Nonlinear Programming, Athena Scientific, 1999 D P Bertsekas, The auction algorithm for assignment and other network flow...
  • 10
  • 321
  • 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Ngày tải lên : 11/08/2014, 05:21
... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... (SD = 3.03) that formed 22% of the total score The maximum score attainable in the active strategies was six and the mean score of the researchers' performance in these strategies was 0.54 (SD...
  • 8
  • 341
  • 0
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

Ngày tải lên : 11/08/2014, 16:21
... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... (SD = 3.03) that formed 22% of the total score The maximum score attainable in the active strategies was six and the mean score of the researchers' performance in these strategies was 0.54 (SD...
  • 8
  • 315
  • 0
A fast algorithm for mining the longest frequent itemset

A fast algorithm for mining the longest frequent itemset

Ngày tải lên : 16/09/2015, 12:35
... Related Work Due to the savings of storing the database in the main memory, the FP-growth algorithm achieves great performance gains against Apriori-like algorithms However it requires that the ... famous algorithms in this domain 2.2.1 Apriori As mentioned before, Apriori [AIS93] [AS94] is a classic algorithm for finding frequent itemsets, since most of algorithms are variants of Apriori ... data warehouses, transactional databases, spatial databases, multimedia databases and the World Wide Web Also there are various kinds of data patterns that can be mined In this section, we examine...
  • 101
  • 345
  • 0
Báo cáo y học: "Validation of a new transpulmonary thermodilution system to assess global enddiastolic volume and extravascular lung wate" pptx

Báo cáo y học: "Validation of a new transpulmonary thermodilution system to assess global enddiastolic volume and extravascular lung wate" pptx

Ngày tải lên : 14/08/2014, 07:21
... and 16 breaths/minute (to maintain an end-expiratory partial pressure of carbon dioxide within the normal range), a positive end-expiratory pressure of cmH2O and a tidal volume of 10 ml/ kg All ... Bendjelid et al Critical Care 2010, 14:R209 http://ccforum.com/content/14/6/R209 for the Care and Use of Laboratory Animals (1996; ILAR, NAP, Washington, DC, USA) Eleven anesthetized and mechanically ... was no longer possible to maintain SaO2 > 90% and MAP >50 mmHg, data collection was stopped and animals were sacrificed (with pentobarbital and phenytoin) Statistical analysis Baseline Haemorrhage...
  • 8
  • 285
  • 0
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"

Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"

Ngày tải lên : 25/10/2012, 10:45
... at the baseline and outcome VARA visits; all other data used for the analysis were from the administrative claims data To test the performance of the effectiveness algorithm and to see whether ... excluded as there was no clinical gold standard with which to compare the algorithm s performance VARA data were used only to capture the DAS28, the CDAI and other clinical characteristics measured at ... scores (DAS), as assessed by physicians using the DAS28 [23] and the Clinical Disease Activity Index (CDAI) [24], as well as a bio-repository with banked DNA, serum, and plasma VARA data have...
  • 29
  • 581
  • 0
Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt

Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt

Ngày tải lên : 23/06/2014, 00:20
... variance Meanwhile, as presented earlier, the variances of the complex Gaussian random variables at the output of the Rayleigh simulator may have arbitrary values, depending on the variances of the ... Note that σ is the variance of complex Gaussian random variables, gj rather than the variance per dimension (real or imaginary) Hence, there is no factor of in the denominator Statistical properties ... variances assumed to be equal to one (for simplicity of explanation) through a Doppler filter changes remarkably the variances of those variables The variances of the variables at the outputs of...
  • 15
  • 602
  • 0
Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx

Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx

Ngày tải lên : 08/08/2014, 14:23
... determining the mutation class of a quiver In [2], the authors prove that the mutation class of an adjacency matrix associated to a triangulation of a bordered surface with marked points is finite (Corollary ... provide a basic tool for study of surface geometry and topology An important reference for us is [2] where the authors construct a cluster algebra associated with triangulations of a bordered surface ... none of the edges in a square can be annihilated and the central node of a square is incident to at least two inward edges and two outward edges Assume the inward edge is a part of a triangular...
  • 45
  • 262
  • 0
Báo cáo y học: "2010 International consensus algorithm for the diagnosis, therapy and management of hereditary angioedema" pdf

Báo cáo y học: "2010 International consensus algorithm for the diagnosis, therapy and management of hereditary angioedema" pdf

Ngày tải lên : 08/08/2014, 21:20
... 2010 in Toronto Canada This manuscript is the 2010 International Consensus Algorithm for the Diagnosis, Therapy and Management of Hereditary Angioedema that was agreed to at that conference and this ... Ontario, Canada 21Ancaster, Ontario, Canada 22St Catharines, Ontario, Canada; Member and Chair, Patient Advisory Committee, Canadian Hereditary Angioedema Network (CHAEN)/Réseau Canadien d’angioédème ... research) to facilitate diagnosis, therapy, management; facilitate data base registries; allow rigorous safety efficacy monitoring of emerging therapies of HAE; and to facilitate access to home therapy...
  • 13
  • 718
  • 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf

Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf

Ngày tải lên : 09/08/2014, 04:20
... shape, and calculating the sap flux as the average of the measurements made at a height of m on a sample of ten trees at Carrasqueira and at a height of 8.5 m on seven We trees at the Bray site The ... was calculated on a leaf area basis by: = where A is the cross-sectional area of the conc ductive pathway and L the leaf area (all sided) of the tree A was measured after the experic ment on the ... Loustau et al [24] For the stem storage only, the elastic storage flux into the trunk was also estimated from trunk volume variations, assuming these variations were due only to the transfer of water...
  • 18
  • 406
  • 0
Báo cáo khoa học: "On the dosimetric impact of inhomogeneity management in the Acuros XB algorithm for breast treatment" pot

Báo cáo khoa học: "On the dosimetric impact of inhomogeneity management in the Acuros XB algorithm for breast treatment" pot

Ngày tải lên : 09/08/2014, 09:21
... photon dose calculation algorithms here analysed, implement totally different approaches, and, for the subject of the study, the main point is focussed to the capability, for Acuros XB, to manage ... reports, for lung tissues, the values of the mean and the standard deviation (average ± SD and range over all the ten patients) of the histograms of the dose difference plans between two calculations ... PTV_adipose Mean and Standard Deviations parameters (in percentage) of the differential DVH for AAA-Acuros11 and Acuros10-Acuros11 difference plans Both parameters are recorded as Mean ± SD and...
  • 11
  • 245
  • 0
Báo cáo khoa học: "The GLAaS algorithm for portal dosimetry and quality assurance of RapidArc, an intensity modulated rotational therapy" pdf

Báo cáo khoa học: "The GLAaS algorithm for portal dosimetry and quality assurance of RapidArc, an intensity modulated rotational therapy" pdf

Ngày tải lên : 09/08/2014, 09:22
... reported as mean values and standard deviations of all the acquisitions per each gantry interval Also the mean values and standard deviations, as well as the range, are reported as global mean of all ... Gamma eval GLAaS meas y profile Patient1 Dose Patient2 Gamma (b) Patient1 Dose Patient2 Gamma Figure Examples of QA for RapidArc plans Examples of QA for RapidArc plans Columns refer to: Eclipse ... GLAaS belong to this category The main benefits of GLAaS applied to RapidArc can be summarized as follows: i) GLAaS performances were proven for static field dynamic IMRT and for standard machine...
  • 10
  • 367
  • 0
Báo cáo y học: "What do we know about communicating risk? A brief review and suggestion for contextualising serious, but rare, risk, and the example of cox-2 selective and non-selective NSAIDs" pot

Báo cáo y học: "What do we know about communicating risk? A brief review and suggestion for contextualising serious, but rare, risk, and the example of cox-2 selective and non-selective NSAIDs" pot

Ngày tải lên : 09/08/2014, 10:23
... available to allow the appropriate calculations As the rather disparate examples in Figures to show, it is unusual to have a coherent set of data available for a single topic because the amount or ... J, Saperas E, Santolaria S, Rodrigo L, Balanzo J, Bajador E, Almela P, Navarro JM, Carballo F, Castro M, Quintero E, Investigators of the Asociacion Espanola de Gastroenterologia (AEG): A nationwide ... dose of drug was allowed in the data, and the table additionally shows the rate and frequency of additional events The calculations used a mortality rate of 10% for gastrointestinal bleeding and...
  • 16
  • 463
  • 0
Báo cáo khoa hoc:"The PX-EM algorithm for fast stable fitting of Henderson’s mixed model" ppt

Báo cáo khoa hoc:"The PX-EM algorithm for fast stable fitting of Henderson’s mixed model" ppt

Ngày tải lên : 09/08/2014, 18:21
... 13 Calving data I: Foulley [6] Calving performance scored according to an increasing level of dystocia as factors of a = sex, b = age of dam, s = sire of calf and t = maternal grandsire of calf ... the vector of variance-covariance components We analyse two data sets; the first is the original data set presented in [6], which we refer to as “Calving Data or CD1”, and the second is a data ... for discussion of the use of a lower triangular matrix as the working parameter) For each of the three EM-type algorithms, the standard procedure described in this paper was applied as well as...
  • 21
  • 240
  • 0
báo cáo khoa học: " Improving eye care for veterans with diabetes: An example of using the QUERI steps to move from evidence to implementation: QUERI Series" ppsx

báo cáo khoa học: " Improving eye care for veterans with diabetes: An example of using the QUERI steps to move from evidence to implementation: QUERI Series" ppsx

Ngày tải lên : 11/08/2014, 16:21
... PRSS might be tailored to function at each site It also was used to provide a platform for discussing the potential advantages or disadvantages of the proposed changes relative to the current system ... necessarily reflect the position or policy of the Department of Veterans Affairs The authors wish to thank Matt Shevrin for assisting with data management throughout the project and, as needed, for ... diabetes is a high-priority issue for the VA and, as part of our goal to reduce preventable morbidity and mortality among veterans with diabetes as previously described, one of several important...
  • 11
  • 443
  • 0
Báo cáo khoa học: "Towards a feasible algorithm for tight glycaemic control in critically ill patients: a systematic review of the literature" pdf

Báo cáo khoa học: "Towards a feasible algorithm for tight glycaemic control in critically ill patients: a systematic review of the literature" pdf

Ngày tải lên : 12/08/2014, 23:21
... workload, fast and accurate point -of- care blood glucose determination, among other factors) and on the prevailing mean blood glucose level before starting a protocol Second, it is preferable to ... venous, or arterial blood for glucose determination It is known that full blood glucose and plasma glucose values differ, and the same is true for arterial and venous blood samples In summary, we can ... determination, among other factors) and on the prevailing mean blood glucose level before starting a protocol Acceptance of the protocol by nurses is very important for successful implementation Key messages...
  • 7
  • 326
  • 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

Ngày tải lên : 13/08/2014, 13:22
... back pain Albeit controversial, Table may lead to a further refinement of risk of osteoarthritis and low back pain based solely on BMI Limitations of obesity as a risk factor for low back pain ... positively associated with low back pain, in particular with chronic or recurrent low back pain [27] What appears to be a main concern in linking obesity as a causal factor for low back pain is the ... Conclusion The data for a link between obesity and low back pain appears to be controversial Yet, this does not adequately address the appropriate therapeutic approach to the obese patient with low back...
  • 6
  • 402
  • 0