0

example of a situation dealing with a difficult customer

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
  • 11
  • 679
  • 0
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Báo cáo khoa học

... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... strategy scores In table 3, the number of years working as a professional and health system research (as compared to basic research) have a significant inverse relationship with the passive strategy ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant...
  • 8
  • 341
  • 0
báo cáo khoa học:

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

Báo cáo khoa học

... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... strategy scores In table 3, the number of years working as a professional and health system research (as compared to basic research) have a significant inverse relationship with the passive strategy ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant...
  • 8
  • 315
  • 0
Difficult People A Practical Guide to Dealing With the 10 Main Types ppt

Difficult People A Practical Guide to Dealing With the 10 Main Types ppt

Kỹ năng giao tiếp

... is always going to feel threatened When you relax and act appropriately, they may calm down a bit You should think of similar people you have dealt with, and find an approach that worked with ... give you a straight answer, no matter how serious the situation It's a pain trying to meet project deadlines with him, and you wouldn't even have a yard sale with him, because he won't make a definite ... when you are dealing with difficult people, they will put you in an uncomfortable situation, and as a result, you may tune them out By listening, you can learn about what others want; even early...
  • 18
  • 657
  • 0
LESSON 22 – Dealing with a situation STUDY NOTES pptx

LESSON 22 – Dealing with a situation STUDY NOTES pptx

Anh văn thương mại

... vocabulary Look up the meaning and pronunciation of these words in your dictionary blame lounge possible calm manager trouble check necessary worker Jumbled sentences - Suggesting an alternative ... alternative explanation Rewrite the sentences with the words in the correct order After you have checked your answers, read each sentence out loud possible that making it back is father own is way your ... like to see the please Is it that he went for a walk around the city? Could you please take a seat in the ? The Chant Practise saying this chant out loud The guest The...
  • 2
  • 481
  • 0
Báo cáo y học:

Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

Báo cáo khoa học

... deiminase 4, are associated with rheumatoid arthritis Nat Genet 2003, 34:395-402 Ikari K, Kuwahara M, Nakamura T, Momohara S, Hara M, Yamanaka H, Tomatsu T, Kamatani N: Association between PADI4 and ... Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, et al.: Functional haplotypes of PADI4, encoding citrullinating enzyme peptidylarginine ... Ikari K, Momohara S, Inoue E, Tomatsu T, Hara M, Yamanaka H, Kamatani N: Haplotype analysis revealed no association between the PTPN22 gene and RA in a Japanese population Rheumatology (Oxford)...
  • 5
  • 406
  • 0
Báo cáo y học:

Báo cáo y học: "Canakinumab relieves symptoms of acute flares and improves health-related quality of life in patients with difficult-to-treat Gouty Arthritis by suppressing inflammation: results of a randomized, dose-ranging study" ppt

Báo cáo khoa học

... Burkhard Moeller, Alexander So, Alan Tyndall; Turkey: Yasar Karaaslan, Ayhan Dinç, Nurullah Akkoç, Taskin Sentürk, Süleyman Ozbek, Ahmet Onat, Ahmet Gül, A Eftal Yücel; UK: Bhavesh Bodalia, Adrian ... Poland: Maria Misterska-Skora; Russia: Evgeny Nasonov, Vadim Mazurov, Marianna Petrova, Andrey Pikhlak, Olga Ershova, Olga Ryabitseva, Anatoly Kuzin, Ludmila Suplotova; Switzerland: Claude Merlin, ... study with canakinumab 150 mg compared with triamcinolone acetonide In addition, treatment with canakinumab 150 mg was associated with a statistically significant better response to treatment according...
  • 13
  • 419
  • 0
BETWEEN TWO WORLDS: AN EXPLORATION OF PRIVACY MANAGEMENT ISSUES ARISING FOR FIRST-YEAR COLLEGE STUDENTS DEALING WITH A MOTHER‟S BREAST CANCER DIAGNOSIS AND TREATMENT

BETWEEN TWO WORLDS: AN EXPLORATION OF PRIVACY MANAGEMENT ISSUES ARISING FOR FIRST-YEAR COLLEGE STUDENTS DEALING WITH A MOTHER‟S BREAST CANCER DIAGNOSIS AND TREATMENT

Quan hệ quốc tế

... dimension to the already stressful diagnosis of parental breast cancer within the family The private and intimate nature of a breast cancer diagnosis may mean that parents are reluctant to fully ... Ingram, 2004; Pistrang & Barker, 1995) In this way, dealing with a devastating disease such as breast cancer has a significant impact on the family as well as the patient During the course of ... their family These two examples are indicative of the permeable boundaries that the family had regarding the disclosure of breast cancer Ms A s family had very permeable boundaries regarding breast...
  • 80
  • 512
  • 0
 Báo cáo y học:

Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"

Y học thưởng thức

... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... by anaesthesiologists in patients with severe trauma revealed that, despite a high success rate and few recorded airway management-related complications, a substantial number of patients with a...
  • 6
  • 611
  • 0
Báo cáo y học:

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

Y học thưởng thức

... There was no organized collection of data that could allow for a structured evaluation of the organizational changes It is evident that a well-planned evaluation of changes in the organizations, ... on performance Acta Anaesthesiol Scand 2010, 54(6):689-695 Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarm procedure ... this article as: Lindström et al.: Implementation of a new emergency medical communication centre organization in Finland - an evaluation, with performance indicators Scandinavian Journal of Trauma,...
  • 5
  • 495
  • 0
Báo cáo y học:

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Y học thưởng thức

... Turkish patients Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; ... 30 days; late, >30 days and very late, >1 year) Myocardial infarction was defined as a creatine kinase (CK) elevation >2 times above the upper limit of normal levels with any associated elevation ... the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety and efficacy of Paclitaxel-eluting...
  • 6
  • 550
  • 0
Báo cáo y học:

Báo cáo y học: " Treatment of oroantral fistula with autologous bone graft and application of a non-reabsorbable membrane"

Y học thưởng thức

... Oral Maxillofac Surg 1994;23:19-21 Haas R, Watzak G, Baron M, Tepper G, Mailath G, Watzek G A preliminary study of monocortical bone grafts for oroantral fistula closure Oral Surg Oral Med Oral ... characteristics of OAC/OAF; the apexes of tooth 26 were in extremely close approximation to the maxillary sinus, and an area of periapical rarefaction was evident (Fig 1) After the failure of the endodontic ... technique after surgical failure The aim of the present case report is to analyze the healing of OAF with the associated use of an autologous bone graft, integrated by xenologous particulate bone graft,...
  • 5
  • 573
  • 0
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

Thạc sĩ - Cao học

... means of the Morris analysis, as in this chapter Examples of the decision variables in RaMCo are the number of fish blasts, the total capacity of urban wastewater treatment plants, and the total ... efficiency of our actions 1.2.3 Integrated management and policy analysis Integrated management Rapid changes of objectives and methodological approaches towards the management of natural resources and ... variables No data Rational validation Stimuli MODEL SYSTEM Objective variables Available data Empirical validation Stimuli REAL SYSTEM Objective variables Figure 2.1 Conceptual framework of analysis...
  • 139
  • 492
  • 0
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

Nông nghiệp

... can get acquainted with the ballot more quickly and shorten the task over each sample evaluation We compared this alphabetized approach with a randomized attribute presentation and found that ... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited via internet and/or phone based on...
  • 10
  • 781
  • 3
Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation

Treatment of Textile Wastewater by a Coupling of Activated Sludge Process with Membrane Separation

Môi trường

... tank and a microfiltration membrane as separation apparatus The aeration tank was made from Plexiglas with a working volume of liters Air was supplied to the aeration tank through diffusers at a ... from chemical treatment is classified as a hazardous waste, so it should be treated in a proper way This means that the sludge disposal causes a substantial increase in wastewater treatment cost ... different samples at various SRT The BOD/COD of influent sample has an average of 0.66 This shows that the denimprocessing wastewater can be classified as rather easily biodegradable waste by aerobic...
  • 8
  • 434
  • 0
Ecological performance of a generalized irreversible Carnot heat engine with complex heat transfer law

Ecological performance of a generalized irreversible Carnot heat engine with complex heat transfer law

Môi trường

... The total heat transfer surface area ( F ) of the two heat exchangers is assumed to be a constant: F = F1 + F2 (3) There exists a constant rate of bypass heat leakage ( q ) from the heat source ... heat transfer coefficient and F1 is the heat-transfer surface area of the hightemperature-side heat exchanger , β is the overall heat transfer coefficient and F2 is the heat-transfer surface area ... irreversible Carnot engine with heat resistance and heat leakage losses [59, 60] Figure The model of a generalized irreversible Carnot heat engine Generalized optimal characteristics The second law of thermodynamics...
  • 14
  • 534
  • 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

Môi trường

... states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public sector oil companies ... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... Gravalos I., Gialamas T., Koutsofitis Z., Kateris D., Xyradakis P., Tsiropoulos Z., Lianos G Comparison of performance characteristics of agricultural tractor diesel engine operating on home and...
  • 12
  • 568
  • 0
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

Môi trường

... southern Asia, and it is a staple food for a large part of the world’s human population especially in east, south and south-east Asia, making it the most consumed cereal grain Rice bran oil is extracted ... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... Nagarajan.G, Mahua (Madhuca indica) seed oil: A source of renewable energy in India, Journal of Scientific and Industrial Research 64, (November 2005): 890 – 896 R Raghu has completed master of...
  • 10
  • 551
  • 0
Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

Tự động hóa

... higher than for the MERS case The influence of actual switch characteristics and thermal capability has been investigated An average peak junction temperature of 125°C and 80°C heat sink temperature ... Ryuichi Shimada, Jan A Wiik, Takanori Isobe, Taku Takaku, Noriyuki Iwamuro, Yoshiyuki Uchida, Marta Molinas, and Tore M Undeland A new ac current switch called mers with low on-state voltage igbts ... a variable capacitor The size of the capacitive injected series voltage can be varied from zero to rated voltage within the current rating of the device This also means that the series voltage...
  • 6
  • 802
  • 0
A contrastive analysis of idioms denoting humans with dispraising implications in english and vietnamese

A contrastive analysis of idioms denoting humans with dispraising implications in english and vietnamese

Khoa học xã hội

... RESEARCH QUESTIONS - What are the syntactic, stylistic and semantic features of grammar and have a wide range of vocabulary can absolutely use IDHDIE and IDHDIV? idioms well because the meaning of ... however, are also known as the roughest part in vocabulary acquisition that learners of a foreign language in general and semantic features of English idioms denoting humans with dispraising implication ... conducted so as to draw out some implications with particular reference to the 3.5 DATA ANALYSIS After finishing the collection of data, we qualitatively describe, analyze and compare the data in two...
  • 14
  • 1,852
  • 4

Xem thêm