example 6 4 balancing a b and pd setting expiration date for a soft drink composition

iec 60439-4 low-voltage switchgear and controlgear assemblies - particular requirements for assem

iec 60439-4 low-voltage switchgear and controlgear assemblies - particular requirements for assem

Ngày tải lên : 25/12/2013, 11:07
... b 043< /b> 9 -4-< /b> ENGL 1999 m 48< /b> 448< /b> 71 070 540< /b> b b52 i 60< /b> 43< /b> 9 -4 < /b> O IEC:1990 +A1< /b> :1995 +A2< /b> :1999 8.2 - 27 - Type tests 8.2.1.1 General The sixth and seventh paragraphs and the note are not applicable Replace table ... Protection against electric shock 60< /b> 3 64 /b> -4-< /b> 46< /b> < /b> (1981): Electrical installations of buildings Isolation and switching - Part 4:< /b> Protection for safety - Chapter 41< /b> : - Chapter 46< /b> :< /b> 60< /b> 3 64 /b> -7-7 04 < /b> (1989): ... Replace the last paragraph by: All connections for external cables shall be re-wireable or shall be socket-outlets Sockets shall conform with the existing standards and have a < /b> current rating of at...
  • 56
  • 514
  • 5
10234 signal words  present simple tense  part 6  4 pages  10 tasks  grammar explanation  key is included  for intermediate ss

10234 signal words present simple tense part 6 4 pages 10 tasks grammar explanation key is included for intermediate ss

Ngày tải lên : 27/08/2016, 18:06
... day / daily 2) The tortoise eats once a < /b> week 3) We go on holiday in July 4)< /b> I am at school in the morning 5) Sarah and her family don’t eat meat on Friday 6)< /b> Daniel has breakfast at quarter to ... often 6)< /b> Joan’s husband shaves _ A < /b> now B in every day C every other day D regularly 7) _ I forget to lock the door A < /b> Never B Always C In a < /b> minute D Sometimes 8) Dora and Floyd dance in a < /b> disco ... question after the nd task: If you use the verb to be, the adverb of frequency has to be before ‘am, are, is’ If you use other verbs, the adverb of frequency has to be before the main verb The answer...
  • 6
  • 483
  • 4
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Ngày tải lên : 21/02/2014, 01:21
... D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86%< /b> D-galactose and 6.< /b> 6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and ... D-galactose, D-galactobiose and D-galactotetraose were used as standards to identify the D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides ... Netherlands) All other standard chemicals were either obtained from Sigma or Merck Potato arabinogalactan and onion arabinogalactan were obtained as described previously (Fractions F 44)< /b> [21] Soy arabinogalactan...
  • 9
  • 669
  • 0
tổng hợp một số dẫn xuất của N-(2,3,4,6-tetra-O-acetyl-B-D-galactopyranosyl)thiosemicarbazid bằng cách ngưng tụ hợp chất này với benzaldehyd thế khác nhau.

tổng hợp một số dẫn xuất của N-(2,3,4,6-tetra-O-acetyl-B-D-galactopyranosyl)thiosemicarbazid bằng cách ngưng tụ hợp chất này với benzaldehyd thế khác nhau.

Ngày tải lên : 20/03/2013, 15:32
... (: 0918.775. 368< /b> *Pha đệm axetat (pH = 4,< /b> 75): Dung dịch đệm pha từ axit axetic muối natriaxetat (pa) Pha nồng độ axit axetic 0,5M muối natriaxetat 0,5M, sau trộn theo thể tích nhau, lắc kỹ đem ... 24 < /b> 25 29 31 31 32 33 34 < /b> 34 < /b> 34 < /b> 34 < /b> 39 42< /b> 42< /b> 42< /b> quang 3 .6.< /b> 3 Xác định Ni2+ lớp mạ phương pháp F-AAS 3 .6.< /b> 4 < /b> Xác định Zn2+ lớp mạ phương pháp chuẩn độ 45< /b> 47< /b> complecxon KẾT LUẬN TÀI LIỆU THAM KHẢO 49< /b> ... nồng độ thuốc thử arsenazo III 10-4M ta thu kết sau : B ng 3.1 : Ảnh hưởng pH đến độ hấp thụ quang A < /b> STT pH 3,5 4,< /b> 5 4,< /b> 75 5,5 0, 069< /b> 0,109 0,1 36 < /b> 0, 160< /b> 0, 169< /b> 0, 168< /b> 0, 160< /b> 0,158 A < /b> Biểu diễn đồ thị:...
  • 65
  • 603
  • 0
E 6 UNIT 12  A 3,4,5

E 6 UNIT 12 A 3,4,5

Ngày tải lên : 27/07/2013, 01:27
... jogs and he plays table tennis a < /b> Which sports does Lan play? b Does Lan play badminton? c Which sports does Nam play? d Does Nam play table tennis? d Does Nam play table tennis? Yes, he does a < /b> ... sports does Lan play? Lan swims, does aerobics, and plays badminton LUCKY NUMBER c Which sports does Nam play? Nam plays soccer, jogs, and plays table tennis LUCKY NUMBER b Does Lan play tennis? ... sports you play? I play table tennis re they doing? A3< /b> -4-< /b> 5 Read Then answer the questions Lan Nam Unit 12: SPORTS AND PASTIMES A < /b> - What are they doing? (A3< /b> -5) T / F Statements: a < /b> Lan and Nam like...
  • 33
  • 609
  • 0
Tieng Anh 6- Unit 4-lesson1.A.

Tieng Anh 6- Unit 4-lesson1.A.

Ngày tải lên : 30/09/2013, 10:10
... Thursday, October 14th, 2010 UNIT4: BIG OR SMALL? Lesson1: A1< /b> -6-< /b> Where is your school? This is Hoa This is her living room This is Hoa’s living room Thursday, October 14th, 2010 UNIT4: BIG OR SMALL? ... country -B, How many classrooms are there? -There are eleven -How many students are there? -There are three hundred and twenty-nine 1 Learn new words by heart Introduce about your school Prepare ... Warm up Look at two pictures and compare two schools Is it a < /b> big school? No, it isn’ t Is it a < /b> big school? Yes, it is Thursday, October 14th, 2010 Unit Big or small? Lesson - Where...
  • 22
  • 457
  • 0
Tieng Anh 6 Unit 4 Lesson2 A 3 - 5

Tieng Anh 6 Unit 4 Lesson2 A 3 - 5

Ngày tải lên : 11/10/2013, 03:11
... country There are classrooms There are 20 classrooms There are 40< /b> 0 students There are 900 students Is many classrooms are in the in in the country Howyour school students areor there in are there ... country There are classrooms There are 20 classrooms There are 40< /b> 0 students There are 900 students Phong’s school is in the country It is small There are eight classrooms There are four hundred ... 21 60< /b> 0 Tell about your school Write about your school This is my school It’s……………………… ………………………………………………… ………………………………………………… ………………………………………………… HOMEWORK • Answer the questions A3< /b> ,4 < /b> p45, 46< /b> < /b> in...
  • 16
  • 752
  • 4
Unit 6 Lesson 2 A 4-6

Unit 6 Lesson 2 A 4-6

Ngày tải lên : 17/10/2013, 00:11
... rice paddy river lake village yard III -A5< /b> Which of these are near your house? Write sentences about your place Example:< /b> There is a < /b> hotel near our house There are trees near our house There is a < /b> ... is a < /b> river near our house There is a < /b> lake near our house There is a < /b> rice paddy near our house Play “chain game” S1: There is a < /b> hotel near my house S2: There is a < /b> hotel and a < /b> river near my house ... hotel and a < /b> river near my house S3: There is a < /b> hotel ,a < /b> river and near my house IV- A6< /b> Play with words Houses and parks, Flowers and trees, Lakes and rivers, We love these ...
  • 10
  • 464
  • 0
Tài liệu Lab 4.2.2 Establishing and Verifying a Telnet Connection pdf

Tài liệu Lab 4.2.2 Establishing and Verifying a Telnet Connection pdf

Ngày tải lên : 11/12/2013, 14:15
... as performed in the Establishing a < /b> HyperTerminal session lab Note: Go to the erase and reload instructions at the end of this lab Perform those steps on all routers in this lab assignment before ... an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 4.< /b> 2.2 Copyright ... mode by typing enable If prompted for a < /b> password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config...
  • 5
  • 533
  • 0
Tài liệu Lab 4.2.2 Establishing and Verifying a Telnet Connection pptx

Tài liệu Lab 4.2.2 Establishing and Verifying a Telnet Connection pptx

Ngày tải lên : 11/12/2013, 14:15
... an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 4.< /b> 2 Copyright ... CCNA 2: Routers and Routing Basics v 3.0 - Lab 4.< /b> 2 Copyright  2003, Cisco Systems, Inc a < /b> Enter enable at the command prompt Enter the password class b What prompt did the router display? What ... Start a < /b> HyperTerminal session as performed in the Establishing a < /b> HyperTerminal session lab Note: Go to the erase and reload instructions at the end of this lab Perform those steps on all routers...
  • 5
  • 494
  • 0
Tài liệu Essay Writing for a Score of 6.0 on the TOEFL and TWE pdf

Tài liệu Essay Writing for a Score of 6.0 on the TOEFL and TWE pdf

Ngày tải lên : 23/01/2014, 06:20
... reasons to make up the three body paragraphs of the essay it is more personal and homey, it is easier to get around in, and it is safer than a < /b> big city For more material and information, please ... than a < /b> big city Develop the Main Ideas: The restatement says that both a < /b> city and town have positive aspects There are many good reasons to live in a < /b> big city and an equal number of good reasons ... is a < /b> valuable experience for teenagers to have jobs while they are students because they will learn to be responsible adults They will have an appreciation for money and they will learn about...
  • 23
  • 784
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Ngày tải lên : 14/02/2014, 19:20
... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1 -4 < /b> (At2g47 060< /b> ): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... redundant and mpk3 ⁄ mpk6 double mutants are embryo lethal [27] The MPK3 and MPK6 kinase activity has been shown to be activated by ROS [28], as well as by bacterial and fungal elicitors [29,30] Because ... separated by SDS ⁄ PAGE and analysed by autoradiography and Coomassie Brilliant Blue R250 staining Plasmids and cloning The OXI1 and PTI1 -4 < /b> coding sequence was amplified by PCR from total cDNA...
  • 11
  • 700
  • 0
Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Tài liệu Báo cáo khoa học: Proteolysis of Pseudomonas exotoxin A within hepatic endosomes by cathepsins B and D produces fragments displaying in vitro ADP-ribosylating and apoptotic effects doc

Ngày tải lên : 18/02/2014, 04:20
... 1, 4a,< /b> 4b, 4d, 6a < /b> and 6c; CPVAAGECA for intermediates 6b and 6d; and PALA for intermediate 4c Western blot analysis with an antibody against ETA showed that cathepsins B and D degraded ETA in a < /b> ... PA EDTA HA E 64 < /b> pH + ATP 60< /b> 60< /b> 60< /b> 60< /b> 60< /b> 60< /b> (min) (Inhibitor) (66< /b> kDa) ETA (37 kDa) ETA -A < /b> C ETA + Cath-D _ ETA + Cath -B 4 < /b> 5 4 < /b> 5 6 < /b> 15 60< /b> 15 60< /b> 15 60< /b> 15 60< /b> 15 60< /b> 15 pH 60< /b> (min) ETA (66< /b> kDa) ETA -A < /b> ... the mobilities of intact ETA ( 66< /b> kDa), ETA -A < /b> ( 37 kDa), and unknown degradation fragments absence of ATP revealed a < /b> small amount of degradation for intact ETA, whereas no degradation was observed...
  • 15
  • 588
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Ngày tải lên : 19/02/2014, 02:20
... TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC ... reverse A < /b> B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ... to Ala was carried out using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT...
  • 14
  • 601
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Ngày tải lên : 06/03/2014, 01:20
... screen Asian American adults for hepatitis B: A < /b> crosssectional study of Asians in California Hepatology 46< /b> (< /b> 4)< /b> :10 34-< /b> 1 040< /b> Lok, A < /b> S., and B J McMahon 2009 Chronic hepatitis B: Update 2009 Hepatology ... ACRONYMS AND ABBREVIATIONS AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC CDC CHIP CI CIA CMS DIS DTaP DUIT DVH EIA EIP EPSDT FDA FEHBP FQHC HAV HBIG HBsAg HBV HCC HCV ... stigma associated with hepatitis B and hepatitis C and guidance on reducing them Information about health disparities related to hepatitis B and hepatitis C To increase knowledge and awareness about...
  • 191
  • 457
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Ngày tải lên : 06/03/2014, 01:20
... this vaccine in 2008 (adult and dialysis formulations of Recombivax HB) and 2009 (pediatric formulations of Recombivax HB and Pediatric Engerix -B) A < /b> shortage was avoided because other manufacturers ... Sciences All rights reserved Hepatitis and Liver Cancer: A < /b> National Strategy for Prevention and Control of Hepatitis B and C http://www.nap.edu/catalog/12793.html Acronyms and Abbreviations AASLD ACIP ... discrimination and stigma associated with hepatitis B and hepatitis C and guidance on reducing them I  nformation about health disparities related to hepatitis B and hepatitis C Copyright © National...
  • 253
  • 369
  • 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Ngày tải lên : 16/03/2014, 05:20
... 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ... was changed to GGA by using primers 5¢-CCCAAGC TTATGGATGGAGGAGGAGAAAAC-3¢ and 5¢-ACGT ACCGGTCCACAATCTAGGAAGTTTGCAGC-3¢ After digestion of the PCR fragment by EcoRI and AgeI, the fragment was inserted ... membrane and probed with anti-FLAG (Sigma), anti-HA (MBL, Nagoya, Japan) or anti-Myc (MBL) sera Coimmunoprecipitation of elongin B and cerulean-elongin C-citrine was similarly performed Measurement...
  • 9
  • 420
  • 0
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

Ngày tải lên : 17/03/2014, 17:20
... antisera and serological assays Polyclonal O-antisera were obtained by immunization of rabbits with heat-inactivated bacteria of P penneri and according to a < /b> published procedure [11] Agglutination and ... 3. 76 < /b> 3.51 3.89 3. 96 < /b> 3.55 4.< /b> 12 4.< /b> 39 3.59 3 .66< /b> 3. 96 < /b> 4.< /b> 05, 3.75 4 < /b> .61< /b> 4.< /b> 02 3. 74 < /b> 3.99 3 .69< /b> a < /b> 4 < /b> .62< /b> 4.< /b> 99 4.< /b> 97 3.32 4.< /b> 09 3. 76 < /b> 3.51 3.92 3.95 3 .62< /b> 4.< /b> 16 < /b> 4.< /b> 36 < /b> 3 .60< /b> 3.87 3.97 4.< /b> 05, 3.75 3.95, 3.73 4 < /b> .61< /b> 4.< /b> 96 < /b> ... 4 < /b> .61< /b> 4.< /b> 96 < /b> 4.< /b> 03 3.58 3. 74 < /b> 3.70 4.< /b> 00 3 .44< /b> 3 .69< /b> 3 .66< /b> a < /b> 3.87, 3.77 a < /b> a a < /b> Signals for H 6a < /b> and H 6b are in the region d 3 .65< /b> ±3.85 Table 13 C NMR data (d, p.p.m.) Chemical shifts for NAc groups are d 23.7...
  • 6
  • 560
  • 0
Đề Thi Thử Đại Học Môn Toán 2013 - Phần 36 - Đề 4 ( Khối A, A1, B, D ) doc

Đề Thi Thử Đại Học Môn Toán 2013 - Phần 36 - Đề 4 ( Khối A, A1, B, D ) doc

Ngày tải lên : 19/03/2014, 06:20
... đứng ABC A < /b> B C tích V Các mặt phẳng ( ABC ' ), ( AB 'C ), ( A'< /b> BC ) cắt A'< /b> O Tính thể tích khối tứ diện O.ABC theo V Gọi I = AC  A< /b> C, J = A< /b> B  AB’ (BA'C)  (ABC') = BI   (BA'C)  (AB'C) ... tỡm B'  I Goi O = BI  CJ  Ta cú O trọng tõm tam giỏc BA’C J Gọi H hỡnh chiếu O lờn (ABC) O Do ABC hỡnh chiếu vuụng gúc BA’C trờn (ABC) nờn H trọng tõm ABC A < /b> V V OH HM   A < /b> ' B AM 1  VOABC ... trí tương đối AB V, ta có: V cắt AB K(1;3;0) uuu r uuu r Ta có KB  KA  A,< /b> B nằm ph a < /b> V Gọi A< /b> điểm đối xứng với A < /b> qua V H hình chiếu A < /b> V uuuu r r x  AH u   1.0  (t  4)< /b> .1  ( 4 < /b>  t ).1 ...
  • 5
  • 377
  • 0