0

exam objectives 7 1 7 2 and 7 5

scjp sun certified aprogrammer for java platform 6th ed

scjp sun certified aprogrammer for java platform 6th ed

Kỹ thuật lập trình

... Exam Essentials Review Questions Answers to Review Questions 88 89 90 91 93 95 97 10 0 10 2 10 4 10 5 10 8 11 1 11 4 11 6 11 6 11 8 12 1 12 4 12 6 12 8 13 1 13 4 13 5 1 37 13 8 14 0 14 3 14 4 1 47 1 47 14 9 15 0 15 1 15 2 ... Exam Essentials Review Questions Answers to Review Questions Chapter xiii 18 8 18 8 19 2 19 4 19 6 1 97 1 97 2 01 20 6 20 9 21 1 21 5 21 8 21 9 22 0 2 21 22 4 2 27 22 9 2 31 23 8 24 2 24 3 24 4 24 5 24 5 24 6 24 6 2 47 2 47 ... Answers to Review Questions Chapter 2 81 2 81 28 3 28 5 28 5 2 87 28 9 2 91 29 4 29 5 29 8 3 01 3 01 303 304 306 306 3 12 3 15 3 15 320 322 324 3 25 326 3 37 Concurrency 3 41 Overview of Threads Writing a Thread...
  • 583
  • 330
  • 0
Báo cáo y học:

Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

Y học thưởng thức

... Positive 23 / 320 44 35 23 21 37 / 640 18 13 16 17 1 / 12 80 / 25 60 37 14 18 11 19 27 12 10 30 13 1 / 5 12 0 21 19 18 20 1 / 10 24 0 10 8 12 3 77 12 2 78 15 9 41 Immuncapture Number of Positive sample 14 4 ... in the 20 0 sera samples were classified as negative, 1/ 320 positive, 1/ 640 positive, 1/ 128 0 positive, 1/ 25 60 positive, 1/ 5 12 0 positive and 1/ 1 024 0 positive ELISA results, on the other hand, were ... comparison Test Sensitivity Spesifity PPD NPD ELISA 90,0 66 ,7 91, 1 63,6 Immuncapture 90,6 76 ,3 94 ,2 65, 9 IgG 73 ,7 58 ,9 84 ,2 42, 8 IgM 72 ,2 67, 8 85 ,2 48 ,7 PPD: positive predictive value NPD: negative predictive...
  • 5
  • 604
  • 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Môi trường

... 9 .2 0 .74 0 . 75 11 8.8 2. 0 51 5 .4 5 02. 4 0.08 9 .5 0 .74 0 .74 10 6.3 2. 0 52 2 .0 5 21 . 5 0.08 9 .2 0 . 75 0 . 75 11 9 .5 2. 0 51 8 .8 51 4 .0 0.08 9.0 0 .76 0 .76 11 8.8 2. 0 51 6 .2 51 6 .3 0.08 9 .1 0. 85 0 .79 70 .1 6.6 489 .1 ... 0 . 75 0 . 75 1 17 . 7 3.0 50 0.0 50 0.0 0.08 9 .1 0 . 75 0 .74 10 5. 9 3.0 50 0.0 50 0.0 0.08 9 .1 0 . 75 0 . 75 76 .3 6.3 496 .1 50 5.9 0. 17 6 .1 0 .74 0 . 75 11 9.8 10 .0 51 9 .0 51 9 .0 0.08 9.9 0 .53 0 . 71 10 8 .2 9.4 51 9 .9 52 2 .2 ... GT 01. f 0 . 75 0 . 75 0 .74 0 . 75 0 . 75 0 .74 GT01a.f S09.p (bar) 0 . 75 1 17 . 7 0 . 75 1 17 . 7 0 . 75 11 9.8 0 . 75 11 6.0 0 . 75 11 9 .5 0 .79 11 9 .5 S14.p (bar) 3.0 3.0 10 .0 2. 0 2. 0 10 .0 50 0.0 50 0.0 0.08 9.3 3.4 50 0.0 50 0.0...
  • 14
  • 593
  • 0
Tài liệu Bài 3: Gradients and Optimization Methods ppt

Tài liệu Bài 3: Gradients and Optimization Methods ppt

Ngân hàng - Tín dụng

... Aw @ w2 which is equal to the matrix is equal to A (3 . 12 ) m wa i =1 i im m wa + j =1 j mj which is equal to the vector Aw + AT w So, =B @ 2a 11 ::: a1m + am1 am1 + a1m ::: 2amm C A (3 .13 ) ... optimization, for example, [46, 13 5, 28 4], and their applications [ 17 2 , 4 07] The speed of convergence of the algorithms is discussed in [28 4, 4 07] A good source for matrix gradients in general is [10 9] The ... second-order gradient of a function g with respect to w as @2g = B B @ @2g @w1 ::: @2g @w1 wm @2g ::: @2g @w2 @w @wm w1 C C A (3 .2) m This is an m m matrix whose elements are second order...
  • 20
  • 408
  • 0
Tài liệu Part III: EXTENSIONS AND RELATED METHODS pdf

Tài liệu Part III: EXTENSIONS AND RELATED METHODS pdf

Hóa học - Dầu khí

... from ( 15 .26 ) For comparison, the line x = y is given by dotted line All the densities were normalized to unit variance, and noise variance was fixed to :3 1. 5 0 .5 2. 5 2 1. 5 1 −0 .5 0 .5 1. 5 2. 5 ... following strongly supergaussian probability density: ( =2 +1) ( ) = 21 (p + 2) ( + 1) 2] ( +3) ( 15 . 25 ) ( + 1) + j j] 0, see Fig 15 .2 When ! 1, the Laplacian density is p s = d = s=d with parameters ... Hyv¨ rinen, Juha Karhunen, Erkki Oja a Copyright  20 01 John Wiley & Sons, Inc ISBNs: 0- 4 71 -4 054 0-X (Hardback); 0- 4 71 -2 21 3 1 -7 (Electronic) 15 Noisy ICA In real life, there is always some kind...
  • 13
  • 379
  • 0
PID ALGORITHM  AND TUNNING METHODS

PID ALGORITHM AND TUNNING METHODS

Cao đẳng - Đại học

... intercept of tangent line and original process value The gain, reset, and Derivative are calculated using: Gain P X/DR Reset Derivative — — 0.3/D PI 0.9X/DR — 0 .5/ D PID 1. 2X/DR 0.5D Ziegler Nichols ... change in output (%) The gain, reset, and Derivative are calculated using: Gain P L/GpD Reset Derivative — — 0.3/D PI 0.9 L/GpD — 0 .5/ D PID 1. 2 L/GpD 0.5D Ziegler Nichols tuning method: closed ... amplitude The gain, reset, and Derivative are calculated using: Gain P 0 .5 GU PI 0. 45 GU PID 0.6 GU Reset Derivative — 1. 2/ Pu 2/ Pu — — Pu/8 Controllability of processes The "controllability" of a...
  • 40
  • 491
  • 0
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

Cao đẳng - Đại học

... soldier, and Thompson is a soldier, and Smith is a soldier, but we can not say, Jones is the 76 th regiment, and Thompson is the 76 th regiment, and Smith is the 76 th regiment We can only say, Jones, and ... Thompson, and Smith, and Brown, and so forth (enumerating all the soldiers), are the 76 th regiment “The 76 th regiment” is a collective name, but not a general one: “a regiment” is both a collective and ... analysis Logic is common ground on which the partisans of Hartley and of Reid, of Locke and of Kant, may meet and join hands Particular and detached opinions of all these thinkers will no doubt occasionally...
  • 1,048
  • 548
  • 0
Prenatal Diagnosis – Morphology Scan and Invasive Methods Edited by Richard Kwong Wai Choy and Tak Yeung Leung docx

Prenatal Diagnosis – Morphology Scan and Invasive Methods Edited by Richard Kwong Wai Choy and Tak Yeung Leung docx

Cao đẳng - Đại học

... revised in 1 978 and 19 83, while a substantial classification took place in 19 98 and was revised in 20 02, 20 06 and 2 010 (INCO, 19 98; Hall, 20 02; Superti-Furga & Unger, 20 07; Warman et al., 2 011 ) However, ... genotype ( 15 59 delT) 30 Prenatal Diagnosis – Morphology Scan and Invasive Methods The c . 15 59 delT carrier frequency is 1/ 480 ( 95% confidence interval, 1/ 1 ,5 62 -1/ 28 4) in Japanese (Watanabe et al 2 011 ) ... disease.Kay,H,pp .1 47, Blackwell publication;ISBN: 978 -1- 4433-33664;UK Karp, LE.; Hayden, PW. (1 977 ) Fetal puncture during midtrimester amniocentesis Obstetrics Gynecology ,vol .11 5, No . 12 , (December 1 977 ),pp . 15 -19 ...
  • 220
  • 1,087
  • 0
POULTRY RATIONS and Feeding Methods ppt

POULTRY RATIONS and Feeding Methods ppt

Nông nghiệp

... cracked wheat may be fed at three weeks, and a little whole wheat after four weeks Chick Starter No lbs 30.0 18 .0 15 .0 10 .0 5. 0 5. 0 5. 0 3.0 5. 0 1. 5 1. 5 0 .5 0 .5 Coursely Ground Wheat Coursely Ground ... (20 0 D) Manganese Sulphate (see below) 10 0.0 Turkey Starter lbs 25 .0 10 .0 15 .0 10 .0 5. 0 10 .0 10 .0 4.0 7. 0 1. 5 1. 0 0 .5 1. 0 10 0.0 To each ton of chick or turkey starter mash, add ounces of powdered ... Meal Meal (50 %) Fish Meal Fine Salt II SUPPLEMENTS (fed daily) (per 10 0 hens) Alfalfa or Clover Skim-milk to drink Fish Oil (20 0 D) 10 0 10 0 75 10 10 lbs lbs lbs lbs lbs lbs Daily gals 1/ 3 cup Winter...
  • 12
  • 617
  • 1
International Macroeconomics and Finance: Theory and Empirical Methods pptx

International Macroeconomics and Finance: Theory and Empirical Methods pptx

Ngân hàng - Tín dụng

... 0.00 51 Long yen position (FT k VT ) Margin 0.0 28 35. 0 4 6 75 .0 75 10 .0 -26 62. 5 48 47. 5 - 450 0.0 3 47. 5 8 9 12 .5 926 0.0 13 600.0 22 860.0 -5 6 25 .0 17 2 35. 0 39 62. 5 21 1 97. 5 2 0 12 .5 23 21 0 .0 -56 50.0 17 5 60.0 6 37. 5 ... Table 1. 1: Yen futures for June 19 99 delivery Date 6 /16 /98 6/ 17 / 98 7/ 17 / 98 8/ 17 / 98 9/ 17 / 98 10 /16 /98 11 / 17 / 98 12 / 17 / 98 01/ 19/99 02/ 17 / 99 03/ 17 / 99 FT k ST k 0 .73 46 0.69 42 0 .77 2 0 . 72 63 0 . 75 07 0 . 71 63 ... form mt = 11 mt1 + 12 st1 + umt , st = 21 mt1 + 22 st1 + ust , (2. 25) (2. 26) where (11 + 21 ) , (1 ) ( 21 + 11 ) 21 = , (1 ) (1t + 2t ) , umt = (1 ) ( + 2 ) Var(umt ) = , (1 )2 2 (1 + ) Cov(umt...
  • 376
  • 776
  • 0
Software Cost Estimation and Sizing Methods - Issues and Guidelines pptx

Software Cost Estimation and Sizing Methods - Issues and Guidelines pptx

Cao đẳng - Đại học

... 55 Sizing-Method Selection 55 Project/System Assessment 56 Sizing-Method Application 57 CHAPTER SIX Approaches to Cost Estimation 61 Using Cost Estimates 62 Buyers ... Time 19 Issue: Calibration 21 vii viii Software Cost Estimation and Sizing Methods: Issues and Guidelines CHAPTER THREE Survey of Sizing Methods 23 Lines of Code 24 Function ... Materials and Manufacturing Processes, MR -1 370 -AF, Obaid Younossi, Michael Kennedy, and John C Graser examine cost-estimating methodologies and focus on military airframe materials and manufacturing...
  • 127
  • 326
  • 0
Building Plans for Poultrymen and Practical Methods of Poultry Raising doc

Building Plans for Poultrymen and Practical Methods of Poultry Raising doc

Nông nghiệp

... thorobreds and decided to embark himself in fowls He decided upon White Leghorns but had only 50 cents I loaned him 50 cents until cherry picking time and he found an advertisement of 25 eggs for $1 He ... for $1 He hatched 23 chicks and raised 21 of the lot and in the fall sold a trio for $10 That was a pretty good investment But even this boy saw he must have better quality and to make a success ... go slow and get the best Rather buy one setting of $5 eggs than 10 0 eggs for $5 for the chicks from the $5 setting eggs will likely be worth more than a dozen raised from the $5 per 10 0 eggs...
  • 132
  • 364
  • 0
an introduction to programming and numerical methods in matlab - s.r. otto & j.p. denier

an introduction to programming and numerical methods in matlab - s.r. otto & j.p. denier

Điện - Điện tử

... 0 .50 000000000000 0.33333333333333 3 .14 15 926 53 58 979 >> format rat; s s = 1/ 2 1/ 3 355 /11 3 >> format ; s s = 0 .50 00 0.3333 3 .14 16 1. 414 2 13 93/9 85 1. 414 21 3 5 62 373 10 1. 4 Vectors in MATLAB 13 There are other options ... s. 2 ans = 16 25 36 2. 50 00 6.0000 1. 5 Setting Up Mathematical Functions 17 >> 1. /s ans = 1. 0000 0 .50 00 0.3333 0 . 25 00 0 .20 00 0 .16 67 1. 0000 1. 50 00 2. 0000 2. 50 00 3.0000 >> s /2 ans = 0 .50 00 >> s +1 ... are given by 1+ 2/ 3*4 -5 = + − = − , 3 , 1/ 2/ 3/4 = (( (1/ 2) /3)/4) = 24 17 1/ 2+ 3/4 *5 = + = , 4 5 -2* 3* (2 +7) = − 6(9) = −49, 16 × ( 1) 4=− , 3 4 (2- 3*(4-3))*4 /5 = (2 − × 1) = − ; 5 (1+ 3)* (2- 3)/3*4 =...
  • 468
  • 601
  • 0
cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks

cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks

Sinh học

... 10 5 10 5 10 6 10 6 1 07 1 07 10 8 10 8 10 9 10 9 11 0 11 0 11 1 11 1 11 2 11 2 11 3 11 3 11 4 11 4 11 5 11 5 11 6 11 6 1 17 1 17 25 Grallert, B and Nurse, P (19 96) The ORC1 homolog orp1 in fission yeast plays a key role ... 57 57 58 58 59 59 60 60 61 61 62 62 63 63 The Budding and Fission Yeasts 64 64 65 65 66 66 67 67 68 68 69 69 70 70 71 71 72 72 73 73 74 74 75 75 76 76 77 77 78 78 79 79 80 80 23 Berry, L D., ... 85 85 86 86 87 87 88 88 89 89 90 90 91 91 92 92 93 93 94 94 95 95 96 96 97 97 The Budding and Fission Yeasts 98 98 99 99 10 0 10 0 10 1 10 1 10 2 10 2 10 3 10 3 10 4 10 4 10 5 10 5 10 6 10 6 1 07 1 07 10 8 10 8...
  • 409
  • 876
  • 0
directed enzyme evolution, screening and selection methods

directed enzyme evolution, screening and selection methods

Sinh học

... at non-permissive temperatures For example, the yeast strain S 111 pol1– 17 ; trp1 28 9 tyr1 ura3 1 ura3 2 ade2 10 1 gal2 can1 pol1– 17 has been used for mutagenesis and selection of novel DNA polymerase ... Rate) [Cam] Positive Wild Type Negative 0† 20 † 40† 80† 25 0† 10 00† 40‡ 20 0‡ 10 0% 10 0% 10 0% 80% 10 0% 40% 10 0% 50 % 20 % 90% 10 % 10 % 75 % 10 % 10 % 50 % 10 % 10 % +++ + – ++ – – [Cam]—concentration of ... Biol Chem 23 6, 11 50 11 57 Fuchs, J A and Karlstrom, H O (1 976 ) Mapping of nrdA and nrdB in Escherichia coli K - 12 J Bacteriol 12 8, 810 – 814 Fontecave, M (19 98) Ribonucleotide Reductases and Radical...
  • 361
  • 263
  • 0
telomeres and telomerase, methods and protocols

telomeres and telomerase, methods and protocols

Sinh học

... Biol 16 , 376 5 – 377 2 19 Scherthan, H., Weich, S., Schwegler, H., Heyting, C., Härle, M., and Cremer, T (19 96) Centromere and telomere movements during early Telomere FISH 20 21 22 23 24 25 26 27 28 ... Science 26 9, 12 67 1 27 0 24 Feng, J., Funk, W D., Wang, S S., et al (19 95) The RNA component of human telomerase Science 26 9, 12 36 – 12 41 25 Nakamura, T M., Morin, G B., Chapman, K B., et al (19 97) ... Fletcher, R., and Razvi, H (20 00) Comparison of human telomerase Introduction to Telomeres and Telomerase 52 53 54 55 56 57 58 59 60 61 62 11 reverse transcriptase messenger RNA and telomerase...
  • 236
  • 344
  • 0
hplc of peptides and proteins, methods and protocols

hplc of peptides and proteins, methods and protocols

Sinh học

... M Wt ~1 14.6 14 .6 14 .9 15 .0 15 .2 15 .3 16 .8 17 . 0 17 . 3 19 .5 10 .7 11 .0 13 5, 500 14 3,000 660,000 16 8,000 480,000 12 0,000 11 5 ,70 0 64,000 1 17 , 50 0 12 9,000 12 5 ,70 0 11 2, 000 11 4,300 Data from refs and The ... 27 0 – 370 60–90 na na 14 0 20 0 18 0 25 0 10 0 50 0 – – – – – – – 25 50 8 ,10 8 ,10 72 5 10 00 10 00 4000 300 22 0±40 400 75 na na na – – – – – 45 16 5 – 40 12 5 10 2. 5 10 50 – – – 10 00 – 12 5 25 0 10 00 300 11 0 16 0 ... – – – – 3 11 3 11 2 12 2 12 2 12 2 12 na pp pp pp,b pp,b pp,b pp,b b AB AB AB AB AB AB AB 1 14 1 14 1 14 1 14 2 8 b b pp pp pp BR BR P P A 2 9 2 9 2 9 2 12 h 2 12 h 2 7. 5h 2 7. 5h 1 14 h 2 8 pp,b...
  • 395
  • 367
  • 0
mrna processing and metabolism, methods and protocols

mrna processing and metabolism, methods and protocols

Sinh học

... CCCAACTGAAGGCTAGGCTGTGG PMA1 p, – 370 PMA1 p, 70 PMA1 cds1, +16 8 PMA1 cds1, + 376 PMA1 cds2, +10 10 PMA1 cds2, + 12 35 PMA1 cds3, +2 018 PMA1 cds3, +22 90 PMA1 cds4, +58 4 PMA1 cds4, +8 07 PMA1 3'UTR top PMA1 3'UTR bottom ... PMA1 and ADH1 and the Galactose-Inducible GAL1 Gene Name/location* Oligo sequence ADH1 p, 23 5 ADH1 p, 18 ADH1 cds1, +14 6 ADH1 cds1, + 3 72 ADH1 cds2, +844 ADH1 cds2, +10 18 ADH1 3'UTR top ADH1 ... Reagents 10 11 12 13 TBS: 20 mM Tris-HCl, pH 7. 5, 15 0 mM NaCl 2X FA lysis buffer (see Subheading 2. 2 .2. ) M NaCl Wash 1: 1X FA lysis buffer/0 .1% SDS/ 27 5 mM NaCl Wash 2: 1X FA lysis buffer/0 .1% SDS /50 0...
  • 267
  • 340
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25