events handlers and all that jazz a little interaction

Procedural Abstraction and Functions That Return a Value

Procedural Abstraction and Functions That Return a Value

Ngày tải lên : 12/09/2012, 22:48
... the formal parameter names  Formal parameters are like placeholders for the actual arguments used when the function is called  Formal parameter names can be any valid identifier Example: double ... parameter names may or may not match variable names used in the main part of the program  It does not matter if formal parameter names match other variable names in the program  Remember that only ... programming language  Top Down Design (also called stepwise refinement)  Break the algorithm into subtasks  Break each subtask into smaller subtasks  Eventually the smaller subtasks are trivial to...
  • 94
  • 541
  • 0
ELA, Promissory Notes and All That: The Fiscal Costs of Anglo Irish Bank pdf

ELA, Promissory Notes and All That: The Fiscal Costs of Anglo Irish Bank pdf

Ngày tải lên : 22/03/2014, 17:20
... WP11/23 Ronald B Davies and Krishna Chaitanya Vadlamannati: 'A Race to the Bottom in Labour Standards? An Empirical Investigation' November 2011 WP11/24 Wen Fan: 'School Tenure and Student Achievement' ... Ireland' July 2011 WP11/14 Olivier Bargain, Kristian Orsini and Andreas Peichl: 'Labor Supply Elasticities in Europe and the US' July 2011 WP11/15 Christian Bauer, Ronald B Davies and Andreas Haufler: ... to banks who pledge collateral that it is not acceptable for Eurosystem operations.   To understand the legal basis for ELA, one has to start with the observation that all of the national  central banks in the Euro area were founded prior to the start of EMU and thus each have pre‐...
  • 28
  • 322
  • 0
Báo cáo y học: " Association between nasal shedding and fever that influenza A (H3N2) induces in dogs" potx

Báo cáo y học: " Association between nasal shedding and fever that influenza A (H3N2) induces in dogs" potx

Ngày tải lên : 11/08/2014, 21:21
... experience canine influenza cases Veterinarians should segregate those Page of animals suspected of carrying influenza that show a high fever (>39.5°C) and thus may spread high viral loads by nasal shedding ... pathological information, MJY: conducted animal care and sample collection, HKK: conducted data analysis, statistical analysis and drawing the figures, SYH: conducted real time RT-PCR for CIV, DJA: participated ... the animal facilities at Green Cross Veterinary Products (Yongin, South Korea) All animal experiments complied with the current laws of South Korea Animal care and treatment were conducted in accordance...
  • 4
  • 279
  • 0
50 little things that make a big difference to team motivation and leadership phần 1 potx

50 little things that make a big difference to team motivation and leadership phần 1 potx

Ngày tải lên : 10/08/2014, 10:21
... invaluable half-hour team sessions that many companies and their managers hold on a daily or weekly basis One idea is to put onto the agenda of each team session: “Feedback—what can I better as ... boss has to It is aimed at any boss who needs to motivate other people on a daily basis This could be a team leader in a bank, a department manager in a retail store, a middle manager in a government ... exceptionally well and achieve the required results on a daily basis as well as in the longer term These bosses understand what the biz is all about and so their teams They are focused and they have...
  • 13
  • 286
  • 0
50 little things that make a big difference to team motivation and leadership phần 2 pdf

50 little things that make a big difference to team motivation and leadership phần 2 pdf

Ngày tải lên : 10/08/2014, 10:21
... both an aspiration and a cause: to end apartheid and unify South Africa It motivated a whole nation—now they are doing the biz and the economy is growing Walt Disney had an aspiration and a cause: ... Leaders are always in pursuit of the best Encouragement, celebration, praise, punishment, and the odd remark and scathing comment are all aspects that can either enthuse or infect a team Motivation ... best imagination The best qualifications The candidate is motivated to achieve great results The candidate has a high degree of self-awareness and is motivated to focus on and develop what he...
  • 13
  • 566
  • 0
50 little things that make a big difference to team motivation and leadership phần 3 pot

50 little things that make a big difference to team motivation and leadership phần 3 pot

Ngày tải lên : 10/08/2014, 10:21
... 3/8/04 7:58 PM Page 23 It virtually happens automatically The skills acquired through training are normally tangible and can be measured Learning, in contrast, is all about motivation and self-improvement ... small—it is imperative that employees are informed immediately, ideally face to face THE BIZ STEP As a team leader set yourself a personal standard: “The first to know after me is my team and that ... waiting times and I can take action on this ✔ I learnt that Ouagadougou is the capital of Burkina Faso and that we have an office there ✔ I learnt about myself—some people think I’m too negative...
  • 13
  • 247
  • 0
50 little things that make a big difference to team motivation and leadership phần 5 pptx

50 little things that make a big difference to team motivation and leadership phần 5 pptx

Ngày tải lên : 10/08/2014, 10:21
... between a manager and a leader The answer is simple A leader is a person who aims to be the best in a designated arena and takes the initiative in becoming so Becoming a leader is not a right that ... is all about performance and delivering what customers expect, what shareholders want, and what the team needs There are a number of performance-enhancing behaviors that a team leader can adopt ... training You as team leader are accountable for training your team and cannot blame head office for failing to deliver that training By hook or by crook you have to make sure that it happens That...
  • 13
  • 368
  • 0
50 little things that make a big difference to team motivation and leadership phần 6 docx

50 little things that make a big difference to team motivation and leadership phần 6 docx

Ngày tải lên : 10/08/2014, 10:21
... leaders are not straight is because they don’t want to demotivate people They are afraid that people would rather not hear what they have to say, or that open and honest criticism will damage a team ... action and are never seen to cooperate The first and most important step to countering this is a “yes” signal from a team leader that cooperation within the team and with other teams is mandatory ... and others hate it Understanding individual motivation means moving away from the traditional “tell” approach to one of listening, understanding, and encouraging Traditional methods of motivation...
  • 13
  • 278
  • 0
50 little things that make a big difference to team motivation and leadership phần 7 docx

50 little things that make a big difference to team motivation and leadership phần 7 docx

Ngày tải lên : 10/08/2014, 10:21
... consultation is that it fuzzes over a prime principle of doing the biz and that is accountability An organization can only thrive when all team leaders and all team members know “I am making a decision ... or facilitated forums, because core to any business are a set of prima facie values that are so intrinsic that they are virtually indisputable One such core value is “care.” Care is all pervasive ... 7:22 AM Page 78 STAMP OUT BAD BEHAVIOR Have a zero-tolerance approach to bad behavior Bad behavior demotivates all around Nobody should be allowed to cross the line between good and bad behavior...
  • 13
  • 261
  • 0
50 little things that make a big difference to team motivation and leadership phần 8 potx

50 little things that make a big difference to team motivation and leadership phần 8 potx

Ngày tải lên : 10/08/2014, 10:21
... person’s character, motivations, skills and experiences, thoughts and feelings as well as the attitude and approach to the exceptionally high standards we set and expect Only in that way can you ... restaurant manager at the Oriental Hotel She has it in a nutshell: “You have to study each team member like a book You have to learn about an individual’s strengths and weaknesses, about each ... subtle nuances of attitude, mood, body language, and eye movement It means understanding each and every word and the meaning behind it, false or genuine It means continually seeking answers to...
  • 13
  • 316
  • 0
50 little things that make a big difference to team motivation and leadership phần 9 pps

50 little things that make a big difference to team motivation and leadership phần 9 pps

Ngày tải lên : 10/08/2014, 10:21
... media is full of speculations, unsubstantiated facts, and assertions that stimulate social intercourse Being indiscreet means giving something away that officially you should not It means revealing ... to say “yes” to suggestions or requests Their essential approach is “can do.” Very rarely they say “can’t do.” There is a chain of hairdressing salons in Taiwan called Mentor that prints a little ... essence and the best team leaders are always on the lookout for new ideas and keep an open mind to all possibilities that come across their path They then exploit them by pioneering a new approach...
  • 13
  • 291
  • 0
50 little things that make a big difference to team motivation and leadership phần 10 pot

50 little things that make a big difference to team motivation and leadership phần 10 pot

Ngày tải lên : 10/08/2014, 10:21
... 7:23 AM Page 110 LOOK HAPPY Take a look at what makes you happy at work and then look happy A good reflection of motivation is a happy look on someone’s face, especially a team leader It is one little ... experimental and challenging Try to reach out and grab any exciting ideas that bubble through the creative cauldron of your recharged mind Explore these ideas avidly and resist the temptation of instant ... (such as a pay increase) will only have a temporary effect Initially the award of a pay increase will put the person on a motivational high Then as time progresses the motivational effect wears...
  • 9
  • 341
  • 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Ngày tải lên : 21/02/2014, 01:21
... Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical ... REFERENCES Fujisawa, H & Hayaishi, O (1968) Protocatechuate 3,4-dioxygenase I Crystallization and characterization J Biol Chem 243, 2673–2681 Murakami, S., Nakanishi, Y., Kodama, N., Takenaka, S., Shinke, ... sucrose Alkali was produced from L-asparagine, citrate, galactarate and tartrate The nucleotide sequence (1457 bp) of the 16S rRNA gene of strain 10d was 96.7% identical with that of Bordetella avium...
  • 7
  • 490
  • 0
Traffic air pollution and mortality from cardiovascular disease and all causes: a Danish cohort study doc

Traffic air pollution and mortality from cardiovascular disease and all causes: a Danish cohort study doc

Ngày tải lên : 06/03/2014, 19:20
... planning data analyses and drafted the manuscript ZA participated in planning the statistical analyses, performed record linkages, data processing and statistical analyses SSJ and MK developed the air ... several decades and mortality from cardiovascular disease and all causes, after adjustment for road traffic noise and other potential confounders The association between air pollution and mortality ... after baseline and for e.g diet and BMI also the time many years before baseline The study population was between 50 and 64 years old at baseline, and lifestyle at these ages are usually relatively...
  • 12
  • 520
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Ngày tải lên : 07/03/2014, 21:20
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... designed: forward 5¢-GATAAGGTACCTGCACTGACACGGATG AAAGC-3¢ and reverse 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
  • 12
  • 561
  • 0
Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

Ngày tải lên : 17/03/2014, 10:20
... (2000) Chemical synthesis and characterization of maurocalcine, a scorpion toxin that activates Ca2+ release channel/ryanodine receptors FEBS Lett 469, 179–185 Mosbah, A. , Kharrat, R., Fajloun, Z., ... bioassays, we tested sPi4 rather than its natural counterpart as the latter is present in too low abundance in the venom of scorpion P imperator to allow a detailed analysis of its structural and ... using a voltage-clamp amplifier (GeneClamp 500, Axon Instruments, Foster City, CA, USA) interfaced with a 16-bit AD/DA converter (Digidata 1200 A, Axon Instruments) for acquisition and voltage protocol...
  • 10
  • 503
  • 0
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

Ngày tải lên : 18/03/2014, 01:20
... promoter fragment The sequences of the oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; Oligo ... PCR reaction with AtCaM5 primers (forward primer: 5¢-GATGTTGATGGTGATGGTCA-3¢; reverse primer: 5¢-AAACCAGCCATGAATGAAAT-3¢) and with actin primers (forward primer: 5¢-GTTGGGAT GAACCAGAAGGA-3¢; ... primer: 5¢-GAACCA CCGATCCAGACACT-3¢) as a control Reactions with no DNA added served as a negative control The PCR cycling profile was: denaturation at 92 °C for 30 s, annealing at 58 °C for and extension...
  • 12
  • 365
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
  • 11
  • 679
  • 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Ngày tải lên : 23/03/2014, 15:20
... small-size NAP (s-NAP; lanes c and c¢), medium-size NAP (m-NAP; lanes d and d¢) or largesize NAP (l-NAP; lanes e and e¢) and exposed to DNase I Controls were the whole genomic DNA (lane a) and ... Saminathan M, Thomas T, Shirahata A, Pillai KS & Thomas TJ (2002) Polyamine structural effects on the induction and stabilization of liquid crystalline DNA, potential applications to DNA packaging, ... modelling was carried out, producing molecular structures that were in strict accordance with biochemical data and theoretical rationales All biochemical data were collected from analytical, electrophoretic...
  • 11
  • 380
  • 0

Xem thêm