equation of motion of a simple pendulum using the lagrangian
Báo cáo y học: "Surgical Treatment of Depressed Scar: A Simple Technique"
... can cause anomalies of the cutaneous surface and textural ir-regularities. A cosmetically acceptable scar is often at the level with the surrounding skin, a good color match, soft, and narrow. ... to the healing of soft tissues after a trauma. However, abnormal or disturbed collagen production can cause anomalies of the cuta-neous surface and textural irregularities. In the presence of ... should start to carry out massages on the entire treated area using moisturiz-ing cream to aid the mobility of the recuperated tis-sue. Fig.1: An example of a depressed scar of the abdomen....
- 3
- 449
- 0
Shaking a box of sand I – a simple lattice model
... mijis the mass of the pile (consisting of grains of unit mass) above grain (i, j). For a rectangular grain, H = 1 − a is the height difference between the initial horizontaland the final vertical ... we say thereforethat when grains are very asymmetrically shaped, and there is a strong preferredorientation, the nonequilibrium regime of granular dynamics will carry all the usualcharacteristics ... irreversible nature of the transition. As mentioned in an earlier chapter, the density may attain values that are substantially higher than random close packing,and quite close to the crystalline limit...
- 10
- 470
- 0
Tài liệu Evaluation of physical activity programmes for elderly people - a descriptive study using the EFQM’ criteria ppt
... etc. were made available by some of the co ordinators. Oth er information was gatheredfrom the web page of the organization.We used standard approaches to statistical analysis of data including ... advertising,more than three quarters of the coordinators revealedthat the programme was promoted. Some authors andorganizations believe that social marketing and com-munication campaigns are a part of a set ... Model of the European Foundation for Quality Manag ement (EFQM)as an operational framework for evaluating the quality of an organization. Within this context, the aim of this studywas to characterize...
- 16
- 959
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... cleaning of the vats and tanks. Too frequently the cans are not cleaned immediately upon arrival at the farm, so that the conditions are favorable for rapid fermentation. Many of the taints ... nitrogen and carbon are most available in the form of organic compounds, such as albuminous material. Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria. ... made in an approximate manner so as to serve as a test at the weigh-can or intake. The test is best made by the use of the well known alkaline tablet which is composed of a solid alkali, and...
- 201
- 540
- 0
Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot
... financial managementLeaders and managers of NGOs have to develop, at the very least, basic skills in financial management. Expecting others in the organisation to manage finances is clearly asking ... cash completes a cash requisition, noting the ãamount advanced the recipient of the cash signs in acknowledgement of receipt of the cash advanceãafter the purchase has been made, the proof of ... N$SUB-TOTALPAYMENTSSUB-TOTALBALANCE END OF PERIOD Fundamentals of NGO ManagementTheunis Keulder & Erika Benz A Practical Guide to the Financial Management of NGOs Published by Namibia Institute...
- 76
- 576
- 0
Principles of Computer Organization and Assembly Language Using the JavaTM Virtual Machine pptx
... smart JVM implementers. A properly written JVM will takeadvantage of the available hardware where practical and will do as many operations as possible using the available hardware. Thus, the ... bits of data, then throw away the extra 4 (useless) bits. The original IBM-PC, based on the Principles of ComputerOrganization andAssembly Language Using the JavaTMVirtual MachinePATRICK ... 10.Inspection of the tables reveals the fundamental connection between binary arithmetic andBoolean algebra. The multiplication table is identical to the AND of the two factors. Addition, of course, can...
- 334
- 2,333
- 1
Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx
... Uámg)1,whicharein the normal range for thermophilic F1-ATPase activity.ATP hydrolysis assayATP hydrolysis was measured using an ATP-regeneratingsystem as a decrease in A 340 of NADH at 25 °C. The assaymixture ... indicated concentrations of MgATP wereaddedat0s.(B)TimecourseofMgATPbindingintheabsenceofPi.MgATP was added as in (A) at 0 s. (C) Dependence of the timeconstant of MgATP binding to the a (W463F)3b(E190Q/Y341W)3c ... ithMgADP at various molar r atios for 10 min. The residualATPase activities at the initial phase were measured byinjecting the mixture into the ATPase assay system. Asshown in Fig. 1A, B (đlled...
- 8
- 443
- 0
THE ECO-TOURISM VALUE OF NATIONAL PARK: A CASE STUDY FROM THE PHILIPPINES pdf
... because of the inability of development and social planners to present a measurable value of the economic resource in question. The lack of a market for the recreational and aesthetic values of ... conducting an ex-post economic valuation of the recreational value of Mt. Pulag. What is really the true value of this program? The overall goal of the study is to measure the recreational value of ... reveals the value that people place on recreational, tourism or leisure aspects of PAs. The study by Navrud and Mungatana (Navrud & Mungatana, 1994) shows that the Travel Cost (TC) and the...
- 32
- 943
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... 5Â-CACCGCCGCCACCATGGGATTGTCACGCAAATCATCAGATGCATCT-3Â and lower primer 5Â-TTAAAATTCACCAAATTCTTTTGCACATT-3Â yielded Cb3ab and Cb3abD4,distinguished by different migration in a 1% agarose gel. The ... (5Â-to3Â)Ca common, human CGGGAACCACTATGCC GTAGCCCTGCTGGTCAATGACb common, human ACACAAAGCCACTGAA (V) TTCCGTAGAAGGTCCTTGAG (VII)Cb1, human CCCTTCTTGCCATCG (I) TTCCGTAGAAGGTCCTTGAG (VII)Cb2, human ... (VII)Cb2, human GCCGGTTATTTCATAGACAC (II) CCTAATGCCCACCAATCCA (VI)Cb3, human AAGACGTTTAGGTGCAAT (III) TTCCGTAGAAGGTCCTTGAG (VII)Cb4, human CCCTTTGCTGTTGGAT (IV) TTCCGTAGAAGGTCCTTGAG (VII)Cb common,...
- 13
- 344
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... were separated using a solvent of chloroform/methanol/water (65 : 35 : 7, v/v/v). Authentic lipid stand-ards (Avanti Polar Lipids, Alabaster, AL, USA) wereseparated alongside the samples for ... min and the reaction stopped by the addition of 50 lLof0.5Msulfuric acid. The plate was read on a LabsystemsMultiskan plate reader using the absorbance difference, A 450 )A 540.Detection of ... 3A, B). These results confirm that Mono-Mac-6 cells can be used as a model for peripheral bloodmonocytes and that the acyltransferase LPCAT plays a significant role in the production of TNF -a and...
- 7
- 322
- 0
SOME ECONOMIC CONSEQUENCES OF GLOBAL AGING: A Discussion Note for the World Bank doc
... et al 2008; Lee and Mason forthcoming). The asset scenario avoids distortionary taxes on labor, which most would view as an advantage. But some see the lack of taxes as a disadvantage since the ... which we can interpret as a form of the ―quantity-quality tradeoff‖. This tradeoff can mitigate the adverse effects of population aging on the economic support ratio by raising the quality and productivity ... expectancy 60, about 5 of the 20 years gained were at 65 and older, about 2 years were gained in the 0-14 age span, and the remaining 13 years were gained in the 15-64 age span. Thus, the increase...
- 38
- 311
- 0
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx
... này mang tính tương đối trang trọng. Sau A large amount of và a great deal of là danh từ không đếm được. Ví dụ: * She has spent a great deal of time in Europe. Sau A large number of là ... đó là danh từ không đếm được và danh từ số nhiều. Ví dụ: * There is plenty of time. * Plenty of shops accept credit cards. A large amount of, a great deal of , a large number of Cách ... chia tương ứng với dạng số nhiều. Ví dụ: * A lot of my friends live abroad. * Lots of time is needed to learn a language. Plenty of Plenty of mang ngh a : “đủ và nhiều hơn n a , theo sau...
- 6
- 1,742
- 11
báo cáo hóa học: " A predictive model of Health Related Quality of life of parents of chronically ill children: the importance of care-dependency of their child and their support system" docx
... content and clarity. The question-naire was also available in English, translated into Englishby a professional translator.Background variables: Demographic and disease related variablesDemographic ... 2Department of Pediatrics, Emma Children's Hospital, AMC; University of Amsterdam, The NetherlandsEmail: Janneke Hatzmann* - j.hatzmann@amc.uva.nl; Heleen Maurice-Stam - h.stam@amc.uva.nl; ... effects of the back-ground characteristics on HRQoL, and the third part (3)contains the effects of the mediating factors on HRQoL. The total effect of a variable on HRQoL can be calculated using the...
- 9
- 565
- 0
báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot
... GCAGAAGTCAACCAGACCGA 311 86.2RC GCAAGTATCCGCAGACGCTCTIMP 2 FOR AACGGCAAGATGCACATCAC 142 85.5RC ATATAGCACGGGATCATGGGINOS FOR GCTATGCTGGCTACCAGATG 139 88.3RC ATCAGCCTGCAGCACCAGAGCOX-2 FOR ACACTCTACCACTGGCATCC ... CondyleCranial Lateral Femoral Condyle Caudal Lateral Femoral CondyleCaudal Lateral Tibial PlateauCranial Lateral Tibial PlateauCaudal Medial Tibial PlateauCranial Medial Tibial Plateau ... percentage of the total area of the tibialand the femoral condyles that stained calculated andrecorded as % area of cartilage damage (%ACD). The %ACD was determined for the tibial and femoral con-dyles,...
- 12
- 521
- 0
Báo cáo hóa học: " Research Article On the Sets of Regularity of Solutions for a Class of Degenerate Nonlinear Elliptic Fourth-Order Equations with L1 Data" doc
... Elliptic Equations of Higher Order, Naukova Dumka, Kiev, Ukraine,1973.[12] O. A. Ladyzhenskaya and N. N. Ural’tseva, Linear and Quasilinear Elliptic Equations,AcademicPress, New York, NY, USA, 1968.S. ... 2002.[2] A. Kovalevsky and F. Nicolosi, “On the sets of boundedness of solutions for a class of degen-erate nonlinear elliptic four th-order equations with L1-data,” Fundamentalnaya I PrikladnayaMatematika, ... elliptic equations, DopovdNatsonalnoă AkademăNaukUkraăni, no. 3, pp. 2428, 1997.[7] A. Kovalevsky and F. Nicolosi, On Hăolder continuity of solutions of equations and varia-tional...
- 15
- 291
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25