endoplasmic reticulum stress as a target of therapy against oxidative stress and hypoxia
Báo cáo y học: " Airway smooth muscle as a target of asthma therapy: history and new directions" docx
Ngày tải lên :
12/08/2014, 16:20
... understanding and treating asthma has been the lack of a good animal model of asthma Asthma is characterized, in part, by AHR, reversible bronchoconstriction, wheezing, inflammation, and cellular ... bronchoconstrictor agents: vis -a- vis, decreased cytosolic levels of Ca2+ (through a variety of actions on plasmalemmal K +and Ca2+-channels [33], as well as the Ca2+-pumps on the plasmalemma and the SR ... IP3- and ryanodine receptor-mediated release of internal Ca2+ and re-uptake of Ca2+ by the Sarcoplasmic/ Endoplasmic Reticulum Ca2+-ATPase (SERCA) are well understood, although their relative...
- 12
- 358
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
Ngày tải lên :
05/03/2014, 17:20
... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and chick embryo [188,189] In the CAM assay, ... screen (Table 1) were previously thought to be safe and are included on the FEMA GRAS list (Flavor and Extract Manufacturers' Association – Generally Regarded As Safe) and the FDA EAFUS list...
- 17
- 733
- 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
Ngày tải lên :
07/03/2014, 17:20
... experiments are unrelated to ASA and A5 , and amino acid residues 202–206 by mAb C, respectively For this reason the reduced reactivity of mAbs A2 and A5 with Gly86Asp and Arg84Gln substituted ASA and mAb ... maturation of epitopes A2 and A5 After 25 of chase, precipitation with mAbs A2 and A5 is almost as efficient as with mAb B1 The location of epitopes suggests that folding of ASA starts within a ... different amino acid-substituted ASAs The results demonstrate that all of these mutant ASAs can be partially stabilized by proteasome inhibition and that the extent of stabilization varies between...
- 10
- 504
- 0
INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY
Ngày tải lên :
24/08/2014, 13:10
... belong to this class of endonucleases Class II AP Endonucleases Class II AP endonucleases are the major class of endonucleases and are also known as hydrolytic endonucleases as they hydrolyze ... Endonucleases can be classified into two classes: Class I AP Endonucleases Class I AP endonucleases are also known as AP Lyases (or β-lyases) as they process the AP sites by the β-elimination reaction, ... unconditionally welcoming me into your family and for always treating me like a daughter and a sister Lastly and most importantly, I want to acknowledge my mum Ranjana Bapat and my late father, Ajit Bapat...
- 156
- 218
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
Ngày tải lên :
06/03/2014, 09:22
... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... tat, rev and nef mRNAs [9], which are transported to the cytoplasm for translation of the Tat, Rev and Nef proteins (Fig 2) All the tat mRNAs are spliced at site A3 The rev mRNAs are spliced at...
- 10
- 434
- 0
Báo cáo khoa học: Misfolded endoplasmic reticulum retained subunits cause degradation of wild-type subunits of arylsulfatase A heteromers pot
Ngày tải lên :
15/03/2014, 23:20
... C-terminus of wtASA (wtASA-HA) or ASAs carrying various amino acid substitutions (D335V-ASA-HA, T274M-ASAHA, P136L-ASA-HA, G86D-ASA-HA and D255H-ASA-HA) (A) BHK cells were transiently transfected ... of plasmid expressing wtASA was cotransfected with 4.2 ng of plasmids expressing various inactive, misfolded ASAs (P377L-pdASA, D335V-ASA, T275M-ASA, P136LASA, G86D-ASA, T201C-ASA and D255H-ASA) ... side chain, pdASA and P377L-pdASA have a lower apparent molecular weight by SDS ⁄ PAGE and can be easily differentiated from wtASA (Fig 2A, bottom) WtASA and P377L-pdASA were expressed separately...
- 11
- 263
- 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx
Ngày tải lên :
16/03/2014, 18:20
... Schizophrenia and Depression (JAB), the National Institute of Mental Health (ACN and RWG), the Department of Defense (JAB and AAF), the Department of Veterans A airs (RWG), and the Ella McFadden Charitable ... (PPM) and phosphoamino acid analysis (PAAA) of mAK-L preparatively phosphorylated by PKC (E) Site-directed mutagenesis analysis of PKC phosphorylation of mAK-L The Coomassie stain and autoradiogram ... [32P]phosphate incorporation was assessed by SDS/ PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled reaction products and radioactive standards were...
- 9
- 497
- 0
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
Ngày tải lên :
19/06/2014, 22:20
... Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto S: Activation of NADPH oxidase in Alzheimer's disease brains Biochem ... microglial NADPH oxidase maybe largely responsible for the oxidative damage observed in the AD brain Astrocytes and the NADPH oxidase Astrocytes are the most abundant glial cell type in the brain and ... increased nucleic acid damage in the AD brain [101,102] However, a direct linkage between these oxidative events and the microglial NADPH oxidase has not been established Antioxidant therapy and...
- 12
- 413
- 0
báo cáo khoa học: "Clinical relevance of "withdrawal therapy" as a form of hormonal manipulation for breast cancer" doc
Ngày tải lên :
09/08/2014, 02:21
... larger datasets and results of ongoing adjuvant trials are needed to provide confirmatory evidence for or against the concept and feasibility of withdrawal therapy in locally advanced and metastatic ... chemotherapeutic agents In this circumstance, withdrawal of therapy may be the only feasible option or alternating regime of endocrine therapy and withdrawal therapy as is being tested in the adjuvant ... Segaloff A, Rubens RD: Assessment of response to therapy in advanced breast cancer: a project of the Programme on Clinical Oncology of the International Union Against Cancer, Geneva, Switzerland Cancer...
- 4
- 253
- 0
báo cáo khoa học: "Mitochondrial and endoplasmic reticulum stress pathways cooperate in zearalenone-induced apoptosis of human leukemic cells" doc
Ngày tải lên :
10/08/2014, 22:21
... DNA content was indicated Percentage of cells in each phase was also evaluated to determine the existence of cell cycle arrest Page of 16 Assay of caspase-3 and caspase-8 activity Cleavage of ... Forward: AAATGAGAAGAGCCCCGTTCTTCCT Reverse: AAGCCACAGGCCTGAGATTTCATCTG NM_004343.3 ERp29 Forward: NM_001034025.1 CCTGAAGATCATGGGGAAGA Reverse: TTCTGGAAGGCAGTCAGGAT GAPDH Forward: GAAGGTGAAGGTCGGAGTC ... specific caspase substrates were used, namely DEVD-AMC (caspase-3 substrate) and IETD-AMC (caspase-8 substrate) ZEA induced in a dose-dependent manner activation of caspase-3 activity but not that of...
- 16
- 227
- 0
báo cáo khoa học: "Emotional stress as a trigger of myasthenic crisis and concomitant takotsubo cardiomyopathy: a case report" pot
Ngày tải lên :
11/08/2014, 02:22
... was calculated as 32% on a cardiac catheterization and 40% on a transthoracic echocardiogram Shortly after cardiac catheterization, she developed bilateral ophthalmoparesis, significant bulbar ... microcirculation of the heart, and elevated catecholamine states [4,7] TC has been described in many different stressful and catastrophic circumstances such as car accidents, family deaths, and even major ... the manuscript JTW analyzed and interpreted the patient’s data and was a major contributor in writing the manuscript AF is a cardiologist who analyzed and interpreted the patient’s data regarding...
- 4
- 237
- 0
Báo cáo y học: " Gigantic retroperitoneal hematoma as a complication of anticoagulation therapy with heparin in therapeutic doses: a case report" docx
Ngày tải lên :
11/08/2014, 23:21
... creatinine kinase, lactate dehydrogenase, amylase and alkaline phosphatase were normal An electrocardiogram (ECG) revealed atrial fibrillation at a rate of 110, with nonspecific ST-segment and ... and T-wave abnormalities A radiograph of the chest showed clear lungs and slight cardiac enlargement A cardiac ultrasonographic examination showed no vegetations, intracardiac Page of (page number ... complication such as conservative management, angiographic evaluation, percutaneous embolization or surgical intervention Case presentation A 57-year-old Caucasian male was admitted to our hospital...
- 5
- 365
- 0
Báo cáo y học: " Classic swine fever virus NS2 protein leads to the induction of cell cycle arrest at S-phase and endoplasmic reticulum stress" potx
Ngày tải lên :
12/08/2014, 04:21
... (5’-CCCATAGTGTCACATACCAG-3’), F1 (5’-GAAGTCGACGGAAAGATAGATGGCGGTT GGCAGC-3’) (the underlined sequences are the Sal I restriction enzyme recognition sites), R1 (5’-GAAGGATCCTCTAAGCACCCAGCCAAGGTGTTCCA-3’) ... Antibodies and reagents Mouse anti-GFP monoclonal antibody (mAb), horseradish peroxidase-conjugated goat anti-rabbit and horseradish peroxidase-conjugated goat anti-mouse antibodies were purchased ... 5’-GGTGATCCCGCCGTCCACT-3’ Tang et al Virology Journal 2010, 7:4 http://www.virologyj.com/content/7/1/4 and PC2: 5’-GATTTACATCTTAGAAAACAAAGGCAGTC-3’ Total RNA was extracted from PK-15 cells and reverse transcribed...
- 12
- 303
- 0
Báo cáo y học: " Autophagy induction and CHOP under-expression promotes survival of fibroblasts from rheumatoid arthritis patients under endoplasmic reticulum stress" pps
Ngày tải lên :
12/08/2014, 11:22
... fibroblasts and rheumatoid arthritis synovial fibroblasts Osteoarthritis synovial fibroblasts and rheumatoid arthritis synovial fibroblasts (OASF and RASF, respectively) were treated with anti-Fas antibody ... induction of autophagy and ER stress that compares OASF and RASF Increased autophagy induction and CHOP underexpression could explain the anti-apoptotic characteristics of RASF, at least when ... resistance against ER stress- induced cell death Page of 11 To explain the mechanism of the findings (that is, the increased autophagy in RASF), we compared the characteristics of OASF and RASF...
- 11
- 290
- 0
Báo cáo y học: "Gene expression response in target organ and whole blood varies as a function of target organ injury phenotype" ppsx
Ngày tải lên :
14/08/2014, 20:22
... triglycerides In addition, an enzymatic activity for the following proteins was measured: alanine aminotransferase, alkaline phosphatase, aspartate aminotransferase, lactate dehydrogenase, and sorbitol ... USA) and serum was separated Clinical chemistry analysis was performed on all rats using a COBAS MIRA (Roche Diagnostics, Montclair, NJ, USA) using commercially available reagents from Equal ... final manuscript Additional data files The following additional data are available with the online version of this paper Additional data file is a table detailing the histopathological scores as...
- 13
- 284
- 0
Reading Theory as a Microcosm of the Four Skills
Ngày tải lên :
06/09/2013, 10:10
... is in their emphasis It is my belief that in giving the L2 student both as much input and practice as they can reasonably manage, and a strong metalinguistic awareness, we, as teachers give the ... Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely central Even with as few details as we ... steps all along An extension of this is the notion of reciprocal teaching and has been in the communicative classroom for many years, and has proven itself to be an extremely effective way of fostering...
- 5
- 680
- 0
Social Phobia as a Consequence of Brain Defects
Ngày tải lên :
01/11/2013, 08:20
... (accepting) accepting and negative and neutral expresssions: activation accompanied by in amygdala, evaluation of: hippocampus, Task performance: parahippocampal recognition of gyrus, medial type of emotion ... conceptually and then experimentally Pharmacological Treatments and the Neurobiology of Social phobia The demonstrated efficacy of various pharmacological compounds reducing distress and avoidance has ... (noradrenaline, adrenaline, and/ or dopamine) and are assumed to reflect a pronounced and persistent increase in sympathetic activity Studies reporting performance-related elevations in noradrenaline and adrenaline...
- 41
- 429
- 0
Social Phobia as a Consequence of Cognitive Biases
Ngày tải lên :
01/11/2013, 08:20
... way as if through the eyes of an observer Again, it is difficult to grasp the meaningfulness of this finding, let alone as evidence of a bias However that may be, this putative ‘‘bias’’ is assigned ... treated as if originating in a scale of equal intervals This violates the basic postulates of the analysis of variance The relevant data should have been properly treated through some form of ... instance of a ‘‘category mistake.’’ According to Ryle (1949) this logical fallacy consists of treating the label for a class of events as if it were a member of that class From this vantage point...
- 41
- 493
- 0
Social Phobia as a Consequence of Inadequate Social Skills
Ngày tải lên :
01/11/2013, 08:20
... value of matching treatment with patients’ patterns of fear Based on extreme responses to a role-play and a ‘‘rationality’’ test, 39 patients were classified as either predominantly behavioral ... definitions aside, I shall now consider how the construct of social skills has been assessed in research Assessment of Social Skills of Social Phobic Individuals As the assessment of social skills had ... consider social phobia not as a breakdown in social ability but as emerging out of a pattern of meaningful actions that constitute a means to an end Although not necessarily abnormal in themselves,...
- 21
- 461
- 0