employment creation as a result of the economic stimulus programme
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
Ngày tải lên :
23/03/2014, 05:22
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... trichostatin A (TSA) resulted in the appearance of a significant amount of acetylated tubulin (Fig 1C, and h; Fig 1D), indicating that both acetylase and deacetylase were present in CAD cells Treatment...
- 14
- 416
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
Ngày tải lên :
17/03/2014, 23:20
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... Mitochondrial free radical generation, oxidative stress, and aging Free Rad Biol Med 29, 222–230 44 Takasawa, M., Hayakawa, M., Sugiyama, S., Hattori, K., Ito, T & Ozawa, T (1993) Age-associated damage ... replicative advantage of human mtDNA carrying a point mutation that causes the MELAS encephalomyopathy Proc Natl Acad Sci USA 89, 11164–11168 49 Wallace, D.C (1997) Mitochondrial DNA in aging and disease...
- 7
- 444
- 0
báo cáo khoa học: "Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature" pptx
Ngày tải lên :
11/08/2014, 02:22
... past tuberculosis, leading to a blockage of lymphatic drainage and resulting in vulval elephantiasis Conclusions Vulval elephantiasis is very rare, and vulval elephantiasis as a consequence of ... skin flaps that was managed by aspiration and pressure bandaging She also experienced episodes of serous discharge from the site that was self limiting and was managed by pressure bandaging Case ... were normal She was taken up for surgery after the correction of her anemia A wide local excision with a primary closure was performed Part of the fibro-fatty tissue of her labia majora was preserved...
- 5
- 457
- 0
Báo cáo y học: "Acute small bowel obstruction as a result of a Meckel''''s diverticulum encircling the terminal ileum: A case report" pdf
Ngày tải lên :
11/08/2014, 10:23
... general anaesthesia, a midline laparotomy was performed on the patient On entering the peritoneal cavity, gross distension of the small bowel and collapse of the large bowel was identified The small ... image his abdomen with a computed tomography scan with oral contrast The result of this revealed a stricture in the terminal ileum, with dilatation of the small bowel proximal and collapse of the ... (TLC55, Ethicon) to release the obstruction Care was taken not to compromise the lumen of the ileum The tip of the diverticulum was then dissected off the terminal ileum and the anastomosis over sewn...
- 5
- 311
- 0
Thuyết trình The Term Structure as a Predictor of Real Economic Activity
Ngày tải lên :
14/07/2015, 11:45
... real rates of interest Fama (1990) finds that an increase in the spread between the 5-year and 1-year bond yield predicts and increase in the rate of inflation for following years and decrease ... indicators, the lagged growth in real output, and the lagged rate of inflation The index of leading indicators is the first obvious choice and consists of twelve macroeconomic variables These variables ... method of adjustment Given that the non – overlapping data may have auto corrected errors, we allow for a moving average of order length longer than k – We choose the lag length of each Newey and...
- 51
- 474
- 0
Reading Theory as a Microcosm of the Four Skills
Ngày tải lên :
06/09/2013, 10:10
... teachers as they are the backbone of many schools in Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely ... central Even with as few details as we have outlined above, there are certain things that we can assume about this group First, given their age group, it is reasonable to assume that many of them ... constraints, at many different levels, on each occasion that they are called upon, they encourage a unique emphasis on particular combinations of strategies on each occasion In reading, the notions...
- 5
- 680
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
Ngày tải lên :
08/03/2014, 10:20
... chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown to consist of a rapid initial ... increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the ... general, the increase in the oxidation rate of crosslinked Hb mediated by LPSs is due to an increase in the rate of the initial fast phase, i.e oxidation of the a chains The rates of oxidation are...
- 6
- 748
- 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx
Ngày tải lên :
18/06/2014, 22:20
... promoting quality of life in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed ... Statistics Canada Classification of chronic conditions The respondents were asked to indicate whether they had a disease or another health condition diagnosed by a health professional that had ... based on full information maximum likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased...
- 11
- 619
- 0
Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
18/06/2014, 22:20
... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... (diacidic) motif was found to be essential for the transport of 3a to the cell surface, consistent with the role of these motifs in the transportation of other proteins to the plasma membrane ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...
- 5
- 310
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part1 ppt
Ngày tải lên :
19/06/2014, 15:20
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
- 11
- 306
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part2 pdf
Ngày tải lên :
19/06/2014, 15:20
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
- 11
- 282
- 0
báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
Ngày tải lên :
20/06/2014, 04:20
... also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments between the endoplasmic reticulum and Golgi apparatus ... (diacidic) motif was found to be essential for the transport of 3a to the cell surface, consistent with the role of these motifs in the transportation of other proteins to the plasma membrane ... and enhance cellcell fusion, a process that is important for viral spreading Table shows a comparison of the amino acid sequences of the cytoplasmic tails of the S protein of different coronaviruses,...
- 5
- 365
- 0
Báo cáo hóa học: " Bilateral hemotympanum as a result of spontaneous epistaxis" doc
Ngày tải lên :
21/06/2014, 07:20
... often associated with temporal traumas rather than nasal packing [1], but occasionally nasal packing, which can lead to peritubal lymphatic stasis, is a cause of hemotympanum [11] Dysfunction of the ... arteriosclerotic vascular diseases are possible systemic factors [5,6] Also regular uptake of anticoagulants can cause spontaneous bilateral hemotympanum [7] The vascular supply of nasal mucosa originates ... In the case presented here, there was no history of nasal packing, so retrograde blood reflux to the Eustachian tube could have been the cause because there was a history of nasal pressure that...
- 3
- 334
- 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot
Ngày tải lên :
07/08/2014, 18:21
... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni ... ehT )ASU ,SSPS ;0.2 noisrev( tatsamgiS ,margorp lacitsitats eht gnisu dezylana saw atad eht llA )deliat-owt( tset deriap a gnisu derapmoc erew noitcefni eht retfa dna erofeb deniatbo seulav citenikocamrahp...
- 5
- 205
- 0
Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf
Ngày tải lên :
11/08/2014, 14:20
... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com ... transvaginal sonogram revealed a sac situated external to the endometrial cavity in the right cornua of the uterus (>1 cm from the most lateral edge of the uterine cavity) containing an embryo measuring ... the data regarding cornual pregnancy and was a major contributor in writing the manuscript Both authors approved the final manuscript Although non-surgical treatment of cornual pregnancies faces...
- 4
- 341
- 0
Báo cáo y học: " Unique challenges for appropriate management of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report" pptx
Ngày tải lên :
11/08/2014, 17:21
... duodenojejunoanastomosis or gastrojejunoanastomosis aimed at bypassing the area of obstruction Alternative surgical management may be removal of the ligament of Treitz in order to relieve the obstruction and ... than a month She began having regular menstrual cycles again, and was able to maintain her weight at an appropriate level One year after discharge from the hospital, her weight was 53 kg, and ... mesenteric artery (SMA) and the aorta While this particular association has been described previously, appropriate management, especially in the setting of the current US healthcare system, has not...
- 5
- 312
- 0
Báo cáo khoa học: " Air embolism as a cause of the systemic inflammatory response syndrome: a case report" pps
Ngày tải lên :
12/08/2014, 19:22
... catheter, approximately 20 hours after the removal of the introducer, the patient’s cardiac index was elevated and the systemic vascular resistance was low These parameters normalized during the ... vascular resistance, tachypnea, fever and diffuse intravascular coagulation) was compatible with the diagnosis of SIRS The rapidity of the patient’s recovery, as well as the lack of positive cultures, ... clinical diagnosis of diffuse intravascular coagulation The patient was transfused several units of packed red blood cells, fresh frozen plasma, platelets and cryoprecipitate Intravenous antibiotic...
- 3
- 219
- 0
Báo cáo y học: "Can choices between alternative hip prostheses be evidence based? a review of the economic evaluation literature" ppsx
Ngày tải lên :
13/08/2014, 11:22
... best to the data; the data are then extrapolated over 60 years While survival is a useful measure of health gain, QALYs have the advantage that they combine length of survival with quality of life ... some cases no abstract at all or no English language abstract was available In the remaining cases it was not clear from the abstract whether or not the study would meet the inclusion criteria From ... evaluation studies report survival rate of the prosthesis as the primary measure of health benefit; either as an observed rate (see Additional file 3, Table S1), or a rate statistically extrapolated...
- 10
- 258
- 0
Báo cáo y học: "HIV transmission as a result of drug market violence: a case report" pdf
Ngày tải lên :
13/08/2014, 13:21
... the analyses of the interview data and prepared the first draft of the article All authors contributed to the design of the study as well to the drafting and revision of the manuscript All authors ... violence has previously been documented as a route of HIV transmission, the details of this case support the conclusion that an assault was very likely the source of infection Additionally, comparison ... authors have approved the final manuscript Acknowledgements The authors wish to thank the study participants for their time and participation We also thank the administrative staff at the B.C...
- 3
- 244
- 0