empirical testing of local cross entropy as a method for recovering asset apos s risk neutral pdf from option prices

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Ngày tải lên : 06/03/2014, 09:22

... ESS3 hnRNP A1 ASF ⁄ SF2 hnRNP H hnRNP A1 SC35, SRp40 ASF ⁄ SF2, SRp40 hnRNP A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA ... Increased splicing at 3¢ss A1 results in the accumulation of vif mRNA and increased inclusion of exon within spliced viral mRNA species A suboptimal 5¢ss signal downstream of HIV-1 3¢ss A1 is necessary ... tat mRNAs are spliced at site A3 The rev mRNAs are spliced at sites A4 a, A4 b or A4 c, and the nef mRNAs are spliced at site A5 [9,10] Nef mostly modulates the physiological status of the host cell...

10
434
0

Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

Ngày tải lên : 08/08/2014, 19:21

... investigated by analysis of variance As previous studies have shown that bud and branch numbers are related to shoot length (Harmer, 198 9a, 199 2a) analyses of these data used length as a covariate; any levels ... period of growth During both periods of growth the total number of buds active was assessed at 8-d intervals — — — At the end of the first period of growth the number of lateral ... sections, which were equivalent to those of the experimental plants, are also termed original, first-flush and second-flush shoots (fig 1) Statistical analysis and presentation of data Due to the large...

14
240
0

báo cáo khoa học: " Whither RDS? An investigation of Respondent Driven Sampling as a method of recruiting mainstream marijuana users" pdf

Ngày tải lên : 11/08/2014, 18:20

... members of the hidden population are connected via social networks as opposed to geographical locations Despite these adaptations, nonrandom methods of selection are criticized as biased insofar as ... elimination of known biases, thus yielding (with large samples) statistics fit for inference to hidden populations [24] RDS allows for an analysis of social structures based on access to some segments ... consumers of these drugs Lessons learned from RDS with marijuana users may extend to other substance users in the mainstream, and other forms of law breaking or risk taking behavior In any case, appropriate...

11
372
0

Design of functional polymeric micelles as a carrier for anticancer drug delivery

Ngày tải lên : 30/09/2015, 06:07

... copolymers Poly(carbonate )s are an emerging class of biomaterials in comparison to the widely used poly(amino acids) and poly(esters) Aliphatic poly(carbonate )s appears to 12 be suitable for use as a ... Their structures also act as a reservoir of functional groups to be tethered to anticancer drugs or for physical encapsulation of said drugs For example, DOX was conjugated to an amidoamine dendrimers ... uptake after the nanocarriers reach the target site from blood circulation and extravasation There are advantages and drawbacks for each of this strategy that will be discussed here The exploitation...

185
1.1K
0

báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

Ngày tải lên : 20/06/2014, 15:20

... healthcare needs of all military healthcare beneficiaries and to target specific health issues For instance, the Health Care Survey of DoD Beneficiaries [8] assesses a broad range of healthcare issues ... longitudinal factors were used to validate self-ratings of health: smoking status and discharge from the military Smoking status at the one-year follow up was assessed using a 7-day point prevalence analysis ... Also, it should be noted that the large sample size of this study may result in small effects reaching statistical significance In summary, a single-item self-assessment of health was consistently...

9
301
0

Development of chick chorioallantoic membrane as a biological testing membrane

Ngày tải lên : 11/09/2015, 10:00

... can be easily seen Hence, it was employed in vasoreactivity studies (Dunn et al., 2005) The vascularity of the CAM allows it to be used as a model to assess damage to the vasculature It was used ... Permeation assays can also be conducted with the use of caco-2 cells Monolayers of these cultivated intestinal epithelial cells are used to assess the mechanism of transport, as well as the quantification ... considerable quantities are needed There are also considerable ethical concerns, thus making human tissues not as easily available In addition, there are risks of diseases transfering to handlers...

202
510
0

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

Ngày tải lên : 29/01/2014, 10:33

... The marking was done with the same way of assessment and then was analyzed in turn The class with English songs in teaching process was called class A, the other was B The same test design was delivered ... from songs 32 A, Musical dictation Songs can be a very good substitute for prose passages in dictation exercises However, songs for this task must have quite easy language and sung at a low speed ... is higher in class B whereas the column of marks seven and eight is higher in class A However, the comparison of the modes reveal that the class B seems to be better than class A as its modes...

39
1.1K
3

Tài liệu The Value of the Case Study as a Research Strategy doc

Ngày tải lên : 20/02/2014, 11:20

... directed against the case study 3.0 Justification for case study as a research strategy This essay has thus far presented the case study as an alternate form of research strategy, suitable for investigation ... multiple sources of information as embedded cases He cautions that embedded cases may be mistakenly classified as holistic cases if a single source has identifiable sub-units - a holistic case design ... real value to qualitative, case-based research This essay has described the case study and its most common manifestations and applications, has briefly discussed the process of preparation, and...

15
587
0

Báo cáo khoa học: Identiﬁcation of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Ngày tải lên : 06/03/2014, 22:21

... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... enhance PYM-induced caspase activation and subsequent PARP cleavage (F) Effect of CA9 ASO on PYM-induced caspase activation on Tca8113 ⁄ PYM cells The relative activation of caspase shown was calculated ... Lysates were incubated at 37 °C for h Samples were measured with an ELISA reader at an absorbance of 405 nm Statistical analyses Quantitative results were expressed as the mean ± standard deviation...

13
563
0

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Ngày tải lên : 07/03/2014, 10:20

... kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 (GSK3) GSK3 has recently been implicated as a critical kinase involved ... availability for treating AD P J Crouch et al established, but the role for metal dyshomeostasis in all aspects is clear In the AD affected brain, metal dyshomeostasis is evident in the form of a substantial ... Ceruloplasmin is increased in cerebrospinal ﬂuid in Alzheimer s disease but not Parkinson s disease Alzheimer Dis Assoc Disord 8, 190–197 Hye A, Lynham S, Thambisetty M, Causevic M, Campbell J, Byers...

9
634
0

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Ngày tải lên : 16/03/2014, 18:20

... linear steady-state conditions In all cases, [32P]phosphate incorporation was assessed by SDS/ PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled ... phosphoamino acid standards Samples were visualized by autoradiography Results Two isoforms of AK are expressed in mouse brain AK was cloned from a mouse brain cDNA library using primers speciﬁc for the ... reaction products and radioactive standards were quantitated using IMAGEQUANT software (Amersham Biosciences) Standards consisted of lL aliquots of serial dilutions of the reaction mixtures,...

9
497
0

Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Ngày tải lên : 18/03/2014, 01:20

... air MALDI mass spectrum of the peptide mixture was obtained using an Autoﬂex mass spectrometer (Bruker Daltonik) Peptide masses were assigned and used for database searching (Swiss Prot) using ... (PMSF) and pepstatin were from Sigma DEAE-cellulose was from Whatman Ampholines pH 3–10 were from Pharmacia Biological preparations A particulate fraction enriched in plasma membranes was prepared ... GTPcS-loaded Rac2, MgSO4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from...

10
396
0

microsimulation as a tool for the evaluation of public policies potx

Ngày tải lên : 19/03/2014, 00:20

359
408
0

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21

... merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae ... cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross- reacted with anti-(R-PsbQ¢), the apparent molecular mass of which was remarkably higher than that of PsbQ¢ (lane ... possess a special type of plastid called cyanelle The cyanelle is surrounded by a peptidoglycan wall [20] and possesses a central body that resembles a cyanobacterial carboxysome [21] which is...

11
501
0

Fermentation as a Method of Food Processing ppt

Ngày tải lên : 24/03/2014, 04:20

... Campbell-Platt (1987) Odunfa (1988) Kuboye (1985) Sudanese (Dirar, 1993) alcoholic beverages (yeast) beverages starchy roots cassava-based kissar – staples cereal products cereals cereals dairy products ... effects of fermentation of cassava by Aspergillus niger B-1 on the cyanide and protein contents of cassava It was shown that the fermentation process reduced the cyanide content of cassava by 95% ... of Aspergillus parasiticus was studied and found to increase in the presence of Lactococus lactis (Luchese & Harrigan, 1990) In contaminated peanut press-cake, Rhizopus oligosporus and Neurospora...

65
538
0

Báo cáo khoa học: "A PROLOG IMPLEMENTATION OF LEXICAL LANGUAGE FUNCTIONAL PROCESSING GRAMMAR SYSTEM AS A BASE FOR A NATURAL" pdf

Ngày tải lên : 24/03/2014, 05:21

... a s~ antic representation has to represent the discourse as a whole and not as the mere union of the s~ antic representations of its isolated sentences A third requirenent a senantlc representation ... graphs The semlntin structures are the result of a translation procedure which is based on the association of formulas of intensional logic to the semantic forms appearing in the functional structure ... 'feat" variables The ~aiqueneas condition is trivially fulfilled since the passing around of parts of the f-structure is done by variables, and PROIOG instantiates a variable with at most one value...

6
476
0

Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx

Ngày tải lên : 29/03/2014, 09:20

... conformations can be assumed In T3SS proteins from bacteria other than EHEC and EPEC, less-ordered proteins such as IpaC from Shigella ﬂexneri, SipC from Salmonella, PopD from Pseudomonas aeruginosa ... signiﬁcant amount of a- helical structure according to CD (A) , but less-dispersed signals are observed in HSQC spectra (B), suggesting a lack of rigid conformation These data indicate that EspB assumes ... Vingadassalom D, Kazlauskas A, Skehan B, Cheng H-C, Magoun L, Robbins D, Rosen MT, Saksela K & Leong JM (2009) Insulin receptor tyrosine kinase substrate links the E coli O157:H7 actin assembly...

7
333
0

Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identiﬁcation of RGD/KGE sequences as binding motifs for C2 domains pdf

Ngày tải lên : 30/03/2014, 11:20

... pull-down assays with native cardosin A purified from pistils of C cardunculus L Cardosin A binds specifically and directly to PLDa fused to GST, and no binding was observed when GST alone was used as a ... recombinant cardosin A were autoactivated and assayed for activity as described by Castanheira et al [34] Binding assays In vitro interactions between native cardosin B, native cardosin A, recombinant ... s1 -casein of cardosins A and B, aspartic proteinases from the flowers of the cardoon Cynara cardunculus L Biochim Biophys Acta 1297, 83–89 10 Ramalho-Santos M, Pissarra J, Verissimo P, Pereira S, ...

13
455
0

Báo cáo hóa học: " A pilot clinical trial testing mutant von HippelLindau peptide as a novel immune therapy in metastatic Renal Cell Carcinoma" doc

Ngày tải lên : 18/06/2014, 16:20

... ELISPOT assay ELISPOT assay All ELISPOT assays were performed at NCI Frederick (CLIA certified lab) The ELISPOT assay using autologous antigen-pulsed DCs was validated and approved by the NIH Vaccine ... follow-up Disease progression was defined as the appearance of new lesions and/or 25% increase of measurable lesions as evident by CT scan Once patients had progressed, follow-up was not required ... extensive lung metastases and was removed from the study after two vaccinations because of rapid deterioration of performance status and disease progression The other five patients received at least...

9
477
0

Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx

Ngày tải lên : 18/06/2014, 22:20

... high activity of GNRH1 (Figure 2B and 4B) was found This activity was 10 higher than in other cases which may indicate patients in metastasis stage Analysis of results demonstrated that in part of ... this article as: Andrusiewicz et al.: CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances Journal of Translational ... identity Data collection and Statistical analysis Real time PCR data was assembled using the LightCycler computer application software 4.05 dedicated for the LightCycler 2.0 All data was analyzed using...

9
460
0