emphasize that the rank 1 and rank 2 projections effectively extract pieces of the starting vector that break it down into smaller parts relative to a locally aligned basis
Tài liệu Báo cáo khoa học: The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium docx
... CeMT -1 and CeMT -2 are required to maintain physiological zinc levels, as lack FEBS Journal 27 7 (2 010 ) 25 31 25 42 ª 2 010 The Authors Journal compilation ª 2 010 FEBS S Zeitoun-Ghandour et al A be rationalized ... (mtl -1_ fwd: 5¢-TATACAT ATGGCTTGCAAGTGTGACTGC-3¢; mtl -1_ rev: 5¢-AGC TTGTCGACGTTAATGAGCCGCAGCAGTTCCC-3¢; mtl -2_ fwd: 5¢-TATACATATGGTCTGCAAGTGTGACT GC-3¢ and mtl -2_ rev: 5¢-AGCTTGTCGACGTTAATGA GCAGCCTGAGCACAT-3¢), ... 55, 913 –9 51 FEBS Journal 27 7 (2 010 ) 25 31 25 42 ª 2 010 The Authors Journal compilation ª 2 010 FEBS S Zeitoun-Ghandour et al 11 Nordberg M & Nordberg GF (20 09) Metallothioneins and related chelators...
- 12
- 611
- 0
Báo cáo khoa học: "Expression of the metalloproteases MMP-1, MMP-2, MMP-3, MMP-9, MMP-11, TIMP-1 and TIMP-2 in angiocentric midfacial lymphomas" potx
... -1, -2, -11 -2 10 11 12 13 14 15 16 17 18 19 20 Endothelium -11 -1, -9, -11 -1, -11 -1, -11 -2 -1, -2, -3,-9, -11 -1 -1, -3, -11 -1, -9, -11 , -13 -1, -2 -3,-9, -11 Epithelium -1, -2, -3, -11 , -13 -1 -2, -3, -11 , -13 , ... -1, -2, -3, -11 , -13 , -1 -1, -9 -1, -2 -1, -3, -11 -1 -1, -2, -3 -1, -11 -1, -3, -11 -11 -1, -3, -11 -1, -2, -3, -11 -2 -1, -2, -3,-9, -11 -1, -3 -1, -2 -1, -2 -1 -1 -1, -2 -1, -2 -1, -2 -1, -2, -3, -13 -1 -1, -3,-9 -2 -1, -11 -1 -1 ... -2, -3, -11 , -13 , -1 -2, -3, -11 , -13 , -1 -1, -2, -11 -1, -2, -3, -11 , -13 -1, -2, -3 -2 -1, -11 -1 -1, -2, -3, -11 , -13 -1, -2, -3, -11 , -13 -1, -13 -1, -2, -3, -11 -1 -1, -2, -3,-9, -11 , -13 -1, -2, -3, -11 , -13 -1 -1, -2, -3 -1, -2 -1, -2, -3, -11 , -13 ,...
- 9
- 247
- 0
Báo cáo y học: "The discovery of the first human retrovirus: HTLV-1 and HTLV-2" doc
... from the Caribbean, and the second was a white merchant marine who acknowledged sexual contacts in southern Japan and the Caribbean These and all subsequent isolates of HTLV -1 in our laboratory ... Morgan, Marvin Reitz, Phil Markham, Prem Sarin, Flossie Wong-Staal, Veffe Franchini, Marjorie Robert-Guroff, M.G Sarngadharan, V.S Kalyanaraman, and Bill Blattner References 10 11 12 13 14 15 Gallo ... RNA-dependent DNA polymerase in virions of RNA tumour viruses Nature 19 70, 22 6 : 12 09 - 12 11 Temin HM, Mizutani S: RNA-dependent DNA polymerase in virions of Rous sarcoma virus Nature 19 70, 22 6 : 12 11- 1 21 3 Robert-Guroff...
- 7
- 303
- 0
Tài liệu Chapter 4: Configuring Layer 1 and Layer 2 Features docx
... (active) goes down 22 :11 :11 : % LINK-DFC3-3-UPDOWN:Interface GigabitEthernet3 /1, changed state to down 22 :11 : 12 : % LINK-DFC3-3-UPDOWN:Interface GigabitEthernet3 /1, changed state to up 22 :11 : 12 : ... {1 | 2} | translate {1- to -1 {dot1q vlan-id | dot1ad vlan-id}| 2- to -1 dot1q vlan-id | dot1ad vlan-id}| 1- to -2 {dot1q vlan-id second-dot1q vlan-id | dot1ad vlan-id dot1q vlan-id} | 2- to -2 {dot1q ... {1 | 2} | translate {1- to -1 {dot1q vlan-id | dot1ad vlan-id}| 2- to -1 dot1q vlan-id | dot1ad vlan-id}| 1- to -2 {dot1q vlan-id second-dot1q vlan-id | dot1ad vlan-id dot1q vlan-id} | 2- to -2 {dot1q...
- 198
- 1,335
- 0
Báo cáo khoa học: Glutathione transferases kappa 1 and kappa 2 localize in peroxisomes and mitochondria, respectively, and are involved in lipid metabolism and respiration in Caenorhabditis elegans pot
... 5030–5040 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 50 31 Glutathione transferase kappa in C elegans A 69 gstk -1 (zk1 320 .1) B AA position rGSTK1 GSTK -1 GSTK -2 4 62 51 150 18 2 15 1 gstk -2 (d2 024 .7) ... thickness) The oven temperature was programmed from 11 0 to 22 0 °C at a rate of °CÆmin )1 and the carrier gas was hydrogen (0.5 bar) The injector and detector were maintained at 22 5 and 24 5 °C, respectively ... (d2 024 .7) E Petit et al 380 599 50 469 10 0 15 0 20 0 C that C elegans ZK1 320 .1 and D2 024 .7 genes belong to the kappa class of GSTs and share a common ancestral gene with rat GSTK1 Firstly, there are conserved...
- 11
- 380
- 0
Handbook of Residue Analytical Methods for Agrochemicals VOLUME 1 and VOLUME 2 doc
... 12 13 12 14 12 14 12 14 12 15 12 15 12 16 12 16 12 16 12 17 12 17 12 17 12 17 12 18 12 19 12 19 12 19 12 19 12 20 12 21 12 21 122 2 12 22 12 22 12 23 12 23 12 23 12 24 12 24 12 25 12 25 12 25 12 26 12 26 12 26 12 27 12 27 xxxiii xxxiv ... Water 10 99 10 99 10 99 11 02 11 03 11 04 11 04 11 04 11 07 11 08 11 10 11 11 111 3 11 15 11 17 11 17 11 27 11 27 11 28 11 28 11 28 11 28 11 30 11 38 11 38 11 39 11 41 114 1 11 42 11 43 11 44 11 44 11 47 11 47 11 48 11 53 11 58 11 59 ... 12 48 12 48 12 49 12 49 12 49 12 50 12 50 12 51 12 51 125 2 12 52 12 52 12 52 12 53 12 54 12 54 12 55 12 55 12 55 12 56 12 57 12 58 12 58 12 59 12 59 12 59 12 59 12 59 12 59 12 60 12 61 12 61 12 61 126 2 12 62 12 63 12 63 12 64 12 64...
- 1,428
- 571
- 0
Báo cáo khoa học: Characterization of inhibitory mechanism and antifungal activity between group-1 and group-2 phytocystatins from taro (Colocasia esculenta) pdf
... K.-M Wang et al 13 14 15 16 17 18 19 20 21 22 jasmonate-treated tomato plants Comp Biochem Physiol C Toxicol Pharmacol 12 7, 20 9 22 0 Felton GW & Korth KL (20 00) Trade-offs between pathogen and herbivore ... F1, 5¢-TTGGATCCATGGCCTTGATGGGGGC-3¢; R1, 5¢-TT GAATTCTTTCCAGAGTCTGAATGATC-3¢; F2, 5¢-TT GGATCCTCGGTTACGCCAGCAGAT-3¢; R1, 5¢-TTGA ATTCTTTCCAGAGTCTGAATGATC-3¢; F2, 5¢-TTGGA TCCTCGGTTACGCCAGCAGAT-3¢; ... for amplification of the FL peptide; F1 and R2 was for the Nt peptide, and F2 and R1 was for the Ct peptide The PCR products were digested with BamHI and EcoRI, and ligated to pGEX-2TK vector (Amersham...
- 10
- 383
- 1
Consolidated Sponsored Occupation List (CSOL): Schedule 1 and Schedule 2 ppt
... 21 2 413 21 2 414 21 2 415 21 2 416 21 2 499 2 21 2 11 2 21 2 12 22 21 1 1 22 21 1 2 22 21 1 3 22 21 9 9 22 2 21 1 22 2 21 2 22 2 21 3 22 229 9 22 2 311 22 2 3 12 22 311 1 22 311 2 22 311 3 22 3 21 1 VETASSESS VETASSESS VETASSESS VETASSESS VETASSESS ... VETASSESS 12 12 21 1 21 2 99 12 1 311 12 1 3 12 12 1 313 12 1 314 12 1 315 12 1 316 12 1 317 12 1 318 12 13 21 1 21 3 22 12 1399 12 1 411 13 111 2 13 111 3 13 111 4 13 21 1 1 13 2 21 1 13 2 311 13 2 411 VETASSESS VETASSESS VETASSESS VETASSESS ... 2 0 12 ANZSCO CODE 2 5 12 11 2 5 12 12 2 5 12 13 2 5 12 14 2 513 11 ASSESSING AUTHORITY AIR AIR ANZSNM AIR VETASSESS 2 513 12 2 514 11 2 515 11 2 515 13 25 21 1 1 25 21 1 2 2 52 311 25 2 3 12 25 2 411 25 2 511 25 2 611 25 2 7 12 25 311 1 25 3 21 1 ...
- 19
- 360
- 0
Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx
... 12 5I- IFN-α The amounts of 12 5I-IFN bound (cpm) to the resistant cell line (15 -1, 15 -2 and 15 -3) are comparable to sensitive cells (Fig 6A) Similar results were obtained with 17 -1, 17 -2 and 17 -3 ... http://www.virologyj.com/content/4 /1/ 89 10 11 12 13 14 15 16 17 18 19 20 Competing interests The author(s) declare that they have no competing interests 21 Acknowledgements 22 This work was supported by NIH grant CA8 9 12 1 (SD) ... Mechanisms of antiviral treatment efficacy and failure in chronic hepatitis C Antiviral Research 20 03, 59 :1- 11 Enomoto N, Sakuma I, Asahina Y, Kurosaki M, Murakami T, Yamamoto C, Izumi N, Marumo...
- 13
- 305
- 0
báo cáo hóa học:" Determinants of quality of life in adults with type 1 and type 2 diabetes" pdf
... Exerc 20 06, 38(8) :15 26 -15 34 Imayama et al Health and Quality of Life Outcomes 2 011 , 9 :11 5 http://www.hqlo.com/content/9 /1/ 115 31 Canada S: Census 20 01- 2B In Health Canada Edited by: Canada H Ottawa, ... 25 4 (22 .1) 1. 1 (1. 2) 1. 6 (1. 2) < 0.00 01 199 (40.6) 22 0 (19 .2) 13 8 (28 .2) 329 (28 .7) 85 (17 .3) 377 ( 32. 9) 44 (9.0) 14 7 ( 12 .8) 20 (4 .1) 62 (5.4) (0.8) BMI (kg/m2) Lifestyle factors 12 (1. 0) 26 .2 (4.6) ... Research Chair and is a Senior Scholar with Alberta Heritage Foundation for Medical Research We are grateful to the statistical and editorial assistance from Nandini Karunamuni 13 14 15 16 Author...
- 9
- 500
- 0
ENCYCLOPEDIA OFSMART MATERIALS VOLUME 1 and VOLUME 2 pot
... Respond to Random Vibration Miner's Cumulative Damage for Estimating Fatigue Life Bibliography 11 15 11 15 11 15 11 15 11 15 11 16 11 16 11 17 11 17 11 17 11 18 11 19 11 19 11 20 11 21 1 12 2 11 23 11 23 11 27 11 28 11 29 ... Application Design Prototype Fabrication and Laboratory Verification Production Tooling and Field Validation Summary Bibliography 11 29 11 29 11 29 11 30 11 30 11 31 113 1 11 32 11 32 11 33 11 33 This page has ... Solid State Commun 11 : 825 – 828 (19 72) 19 D Berlincourt, J Acoust Soc Am 70(6): 15 86 15 95 (19 81) 20 D Waller, T Lqbal, and A Safari, J Am Ceram Soc 72( 2): 322 – 324 (19 89) 21 N Lamberti, A Iula, and...
- 1,073
- 446
- 0
Báo cáo lâm nghiệp: "Environmental control of CO assimilation rate and leaf 2 conductance in two species of the tropical rain forest of French Guiana (Jacaranda copaia D. Don and Eperua falcata Aubl.)" pdf
... absence of any role of leaf water status in explaining the afternoon depression of A in a range of species of the temperate zone In fact, the diurnal changes in A in the J copaia leaflets were clearly ... soil and atmospheric drought on photosynthesis and stomatal control of gas exchange in three coniferous species PhysioL Plant 73, 97 -10 4 Jones H.G (19 85) Partitioning stomatal and non-stomatal ... stomatal resistance of Prunus armeniaca L under desert conditions I A simulation of the daily time course of stomatal resistance Oecologia 17 , 15 9 -17 0 Tenhunen J.D., Pearcy R.W & Lange O.L (19 87)...
- 5
- 324
- 0
Báo cáo y học: "Expression of novel extracellular sulfatases Sulf-1 and Sulf-2 in normal and osteoarthritic articular cartilage" pdf
... chondrocyte and contributes to OA progression FGF2 may regulate Sulf expression and maintain the anabolic and catabolic balance in cartilage Sulf -1 also mediates 6-O desulfation of the heparan sulfateWnt ... Arthritis Rheum 20 00, 43 :19 16 -19 26 Lotz M: Cytokines in cartilage injury and repair Clin Orthop Relat Res 20 01, 3 91( Suppl):S108 -11 5 Sandell LJ, Aigner T: Articular cartilage and changes in arthritis ... presence of the HSPGs that are the major known sulfatase substrates in articular cartilage In addition, there appears to be similar expression of the enzymes and substrates in OA-affected cartilage...
- 8
- 388
- 0
báo cáo khoa học:" Determinants of quality of life in adults with type 1 and type 2 diabetes" ppsx
... Yes 490 (10 0.0) 25 4 (22 .1) Number of comorbidities 1. 1 (1. 2) 1. 6 (1. 2) < 0.00 01 (range 0-5) 19 9 (40.6) 22 0 (19 .2) 13 8 (28 .2) 329 (28 .7) 85 (17 .3) 377 ( 32. 9) 44 (9.0) 14 7 ( 12 .8) 20 (4 .1) 62 (5.4) ... 20 06, 38(8) :15 26 -15 34 31 Canada S: Census 20 01- 2B In: Health Canada Edited by Canada H Ottawa, Ontario 20 01: 1- 32 32 Saucier G, Ostendorf F: Hierarchical subcomponents of the Big Five personality ... Exercise and Diabetes Research Advancement (ALEXANDRA) study was a population-based, longitudinal study of physical activity determinants in adults with diabetes in Alberta, Canada The baseline data...
- 34
- 254
- 0
Báo cáo y học: "Seroprevalence of hepatitis B and C virus in HIV-1 and HIV-2 infected Gambians" pps
... 50:4 01- 406 Jobarteh et al Virology Journal 2 010 , 7 :23 0 http://www.virologyj.com/content/7 /1/ 23 0 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 WHO: Global surveillance and control of hepatitis ... the 5′UTR (KF2 - TTCACGCAGAA AGC GTCTAG and 21 1 -CACTCTCGAGCAC CCTATCAGGCAGT) and NS5b (HCVN S5F2-TATGA TACC CGCTGCTTTGACTCG; HCVNS 5R2c-CTGG TCATAGCCTCCGTGAAGGCTCTCAGG and HCVN S5 R2d-CTGGTCATAGCCTCCGTGAAGGCTCGTA ... Age 0-9 years 10 -24 years 25 -34 years (10 0.0) (50.0) 6.7 × 10 2. 9 × 10 2 (28 .5) (7 .1) 1. 1 × 10 6.6 × 10 3 (29 .4) ( 21 . 3) 6.3 × 10 3 4.9 × 10 2 35-44 years (69 .2) 1. 9 × 10 2 (0.0) – ( 52. 9) 1. 9 × 10 2...
- 9
- 474
- 0
Báo cáo y học: " Kinetic studies of HIV-1 and HIV-2 envelope glycoprotein-mediated fusion" potx
... using the 'Quikchange' site directed mutagenesis kit (Stratagene, La Jolla, CA) and 5' GGGAGACATAAGAGATGAAAGCTTGTGCTAGGGTTC 3' and 5' GAACCCTAGCACAAGCTTTCATCTCTTATGTCTCCC 3' oligonucleotides to ... tail [20 ] HIV -1, HIV -2 and SIV CTs are remarkably long and contain domains that likely interact with host cell components, such as calmodulin [ 21 , 22 ], α-catenin [ 21 ] , p 115 -RhoGEF [23 ], Prenylated ... participated in the design of the study and helped to draft the manuscript and RB conceived of the study, participated in its design and coordination and wrote the manuscript All authors read and approved...
- 8
- 221
- 0
Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot
... citation purposes) Retrovirology 20 07, 4: 31 http://www.retrovirology.com/content/4 /1/ 31 A CD8 CD4 - aCD3/aCD28: + - + mAb1 418 10 0 10 1 10 2 10 3 10 0 10 1 10 2 10 3 10 0 10 1 10 2 10 3 10 0 10 1 10 2 10 3 a- Glut-1C-term ... 19 90, 26 6(3):799-808 Page of (page number not for citation purposes) Retrovirology 20 07, 4: 31 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Afzal I, Browning JA, Drew C, Ellory JC, Naftalin ... drafted the manuscript together with MS and JLB All authors read and approved the final manuscript Acknowledgements We are grateful to all members of our laboratories for their critical input and advice...
- 9
- 283
- 0
Báo cáo y học: "Circulating angiopoietin-1 and angiopoietin-2 in critically ill patients: development and clinical application of two new immunoassays" pot
... Ang -1 and Ang -2 Materials and methods Angiopoietin -1 immunoradiometric sandwich assay A polyclonal anti-human Ang -1 affinity-purified goat IgG antibody (PAB) and a monoclonal anti-human Ang -1 mouse ... limits and precision The detection limit of the Ang -1 IRMA, calculated as the mean ± three standard deviations for 10 replicate measurements of the zero standard (calibrator free of analyte), was ... lots of tubes, tracer, and calibrator The inter-assay imprecision was 8.4% and 8.8% for samples containing 1. 7 ng/ml (1. 5 to 1. 9 ng/ml) Ang -1 and 21 . 8 ng/ml (17 .9 to 22 .9 ng/ml) Ang -1 We also evaluated...
- 11
- 311
- 0
Báo cáo y học: "Differential gene expression patterns in cyclooxygenase-1 and cyclooxygenase-2 deficient mouse brain" ppsx
... CoA Fatty Acid Toscano et al Citrate synthase Citrate 3-ketoacyl CoA Acetyl CoA Acetyl CoA CoA ACAT1 (2. 3 .1. 9) Z-score= +1. 83 Q-PCR= +58% MITOCHONDRIA ATP CYTOSOL ATP Citrate Lyase (2. 3.3.8) Z-score= ... http://genomebiology.com /20 07/8 /1/ R14 R14 .10 Genome Biology 20 07, 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 Volume 8, Issue 1, Article R14 Toscano et al Resting and arecoline-stimulated brain ... Itouji A, Sakai N, Tanaka C, Saito N: Neuronal and glial localization of two GABA transporters (GAT1 and GAT3) in the rat cerebellum Brain Res Mol Brain Res 19 96, 37:309- 316 Nishimura M, Sato K, Mizuno...
- 10
- 264
- 0
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008