elegans as a model system for studying aging

Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf

Ngày tải lên : 24/03/2014, 00:21

... concentration of Na+ activates pyruvate kinase without K+ [27] The reaction was initiated by an addition of lg enzyme K+-activated phosphatase activity was determined as K+-dependent pNPPase activity ... mixer and subjected to ultrasonication RESULTS Effects of pressure on Na+/K+-ATPase, Na+-dependent ATPase and K+-activated phosphatase activities It could be con®rmed that the Na+/K+-ATPase activity, ... (n), and Na+-dependent ATPase activities (m) Each activity was measured at various pressures and 37 °C as described in Experimental procedures Speci®c activities of Na+/K+-ATPase, K+-activated...

9
432
0

Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt

Ngày tải lên : 14/08/2014, 16:21

... (where applicable) and N-pyroglutamate were allowed as variable modifications Due to the high mass accuracy, the 99% significance threshold (p < 0.01) in the yeast database search was a Mascot ... sequence database This database was complemented with frequently observed contaminants (porcine trypsin, achromobacter lyticus lysyl endopeptidase and human keratins) A 'decoy database' was prepared ... precursor mass error several fold and we achieved a final average absolute mass accuracy of 2.6 ppm This enabled a second-pass database search with more stringent MS tolerance, in this case 10 ppm...

15
267
0

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

Ngày tải lên : 15/05/2015, 00:37

... ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified ... zebrafish embryos among scientists (Figure 1. 2A) as well as legislators: The International Organization for Standardization (ISO) has standardized the zebrafish embryo test for waste water quality ... Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays Moreover, as a complex and independent organism retaining...

58
262
0

Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx

Ngày tải lên : 09/08/2014, 23:20

... the families Viperidae (for example, rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research ... University of California Santa Cruz [32] and NCBI [33] genome browsers for public queries as soon as it is available and passes contamination analyses, and relevant announcements and links will ... comparative data to estimate genomic characteristics of the ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, including estimation of ancestral gene family...

8
410
0

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Ngày tải lên : 22/03/2014, 17:20

... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have ... engraftment was achieved using both methods as shown by expression of human CD45 3–6 months post-transplantation Additionally, secondary engraftment was achieved following intravenous transplantation...

12
550
0

Báo cáo hóa học: " Research Article CARNIVORE: A Disruption-Tolerant System for Studying Wildlife" docx

Ngày tải lên : 21/06/2014, 11:20

... interval Reinstate task Each tick Reinstate task Transmit Reinstate task b Sample accelerometer If buﬀer full Reinstate task a Scheduler Tasks a Save accel data b Process frames GPS machine task ... receive data A single MAC layer task parses frames rapidly and updates the state variables for each task A neighbor table is maintained at each CSN that stores the neighbor ID and a ranking metric ... the data transfer task All nodes that sent nominations and received acceptances become senders in the data transfer task SRNs always have a metric of and will therefore always win an election and...

14
378
0

Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx

Ngày tải lên : 06/08/2014, 19:21

... of Daphnia The study of parasites (viruses, bacteria and multicellular parasites) has also gained momentum as a result of their influence on Daphnia ecology and evolution [3] Parasites can directly ... populations Genetic variation has been reported in Daphnia for a vast number of traits such as size, aging, Page of behavior (for example, vertical migration, fish-escape behavior), morphology (for ... comparative analysis of neural characters in higher crustaceans (malacostracans) and insects For example, in both insects and malacostracans, stem-cell-like neuroblasts have been detected that...

4
318
0

Báo cáo y học: "Vasculature deprivation – induced osteonecrosis of the rat femoral head as a model for therapeutic trials" ppsx

Ngày tải lên : 13/08/2014, 23:20

... Legg-Calvé-Perthes disease J Pediatr Orthop 1993, 13:41-45 Kumasaka Y, Harada K, Watanabe H, Higashihara T, Kishimoto H, Sakurai K, Kozuka T: Modified epiphyseal index for MRI in LeggCalvé-Perthes disease (LCPD) ... epiphyseal hard and soft tissues and articular cartilage [19], matching Sokoloff's concept of degenerative joint disease as a deranged tricompartmental articulation [23] The articular aspect demonstrates ... indicate that the intraosseous conduits support an exaggerated revascularization of the formerly avascular femoral heads To conclude, the above alterations are unmistakably exclusive to the healing...

14
357
0

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Ngày tải lên : 05/09/2013, 14:58

... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... that incorporates the significant physical processes and the key parameters affecting fuel cell performance The model accounts for both gas and liquid phase in the same computational domain, and ... reduces to Darcy’s law, which is, however, based on the relative permeability for the gas phase (KP ) The relative permeability accounts for the reduction in pore space available for one phase due...

18
549
0

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Ngày tải lên : 05/09/2013, 15:28

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... endo-glucanase, exo-glucanase and β-glucosidase Endo-and exo-glucanases are commonly referred to as “cellulases” Fungal strains of Trichoderma reesei are used to produce most commercial cellulase...

20
437
0

A general framework for studying class consciousness and class formation

Ngày tải lên : 01/11/2013, 07:20

... collectively organized social forces within class structures Class formation thus includes the formation of class alliances as well as the internal organization of classes as such For example, ``populism,'' ... ``weak'' class formations; unitary or fragmented class formations; revolutionary, counterrevolutionary or reformist class formations Typically, class formations involve creating formal organizations ... working-class or capitalist-class interests Limitation, selection and transformation In elaborating a micro -model of class consciousness and a macro -model of class formation we will describe the causal...

31
500
0

A practical guide for studying chua's circuits

Ngày tải lên : 12/12/2013, 08:29

... Chuas Circuit Model 3.1 FPAA: General Concepts and Design Approach 3.2 FPAA-Based Implementations of Chuas Circuit Model 3.2.1 FPAA-based Chuas circuit model- I 3.2.2 FPAA-based Chuas ... chosen as Ga 0.756 mA/V, Gb 0.409 mA/V and 10 A Practical Guide for Studying Chuas Circuits Bp = V with the circuit parameters in Fig 1.9 (a) As Chuas circuit has a simple and easily configurable ... the use of MATLABTM and SIMULINKTM in dynamic modeling and simulation of Chuas circuit Field programmable analog array (FPAA) is a programmable device for analog circuit design and it can be effectively...

217
628
0

Tài liệu Speak Without Fear: A Total System for Becoming a Natural, Confident Communicator docx

Ngày tải lên : 27/01/2014, 08:20

... before the event My husband, David, is a bass player Back in the mid-’80s, he was playing a beneﬁt to save Broadway theaters, which were then being demolished at an alarming rate As he was waiting ... manager insisted on it As a supervisor, Ryan now had to give in-person reports to top management on a regular basis Every time his manager asked for an advance look at Ryan’s presentation, Ryan ... people has taught me never to assume that simply acquiring or reﬁning a particular skill will mean that all is immediately and always well Using what you’ve learned about yourself so far as a guide...

65
455
0

Tài liệu POSSUM: a scoring system for surgical audit docx

Ngày tải lên : 17/02/2014, 21:20

... the porta hepatis Discussion As far as we are aware, this is the first case of classical hepatocellular carcinoma occurring in a cirrhotic liver A 39-year-old male Caucasian cabinet-maker presented ... et at 56 46 t Discussion Surgical audit has increased in importance over the past few years, both as an educational process and as a means of assessing the quality of surgical care We felt that ... risk factors in patients with peripheral vascular disease Surgery 1978; 84: 505-9 Domaingue CM, Davies MJ, Cronin KD et al Cardiovascular risk factors in patients for vascular surgery Anaesth...

6
369
0

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Ngày tải lên : 18/02/2014, 16:20

... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon for ... 5¢-AA GCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATC CAAGAACTGTGTATGTCTG-3¢ The 1.6-kbp fulllength Skn cDNA, whose termination codon was changed to a BamHI site, was inserted between the SalI and the BamHI...

14
499
0

Tài liệu A PRACTICAL GUIDE FOR STUDYING CHUA''''S CIRCUITS doc

Ngày tải lên : 18/02/2014, 22:20

... Chuas Circuit Model 3.1 FPAA: General Concepts and Design Approach 3.2 FPAA-Based Implementations of Chuas Circuit Model 3.2.1 FPAA-based Chuas circuit model- I 3.2.2 FPAA-based Chuas ... chosen as Ga 0.756 mA/V, Gb 0.409 mA/V and 10 A Practical Guide for Studying Chuas Circuits Bp = V with the circuit parameters in Fig 1.9 (a) As Chuas circuit has a simple and easily configurable ... the use of MATLABTM and SIMULINKTM in dynamic modeling and simulation of Chuas circuit Field programmable analog array (FPAA) is a programmable device for analog circuit design and it can be effectively...

217
584
0

Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc

Ngày tải lên : 20/02/2014, 01:20

... mm NaCl, and · protease inhibitor cocktail at 37 °C for 20 The lysate was spun down at 50 000 g for 15 The supernatant was mixed with pre-equilibrated anti-HA afﬁnity matrix and rocked at °C for ... Valencia, CA, USA), and rocked at °C for h The lysate ⁄ Ni ⁄ nitrilotriacetate bead mixture was transferred to a poly prep chromatography column and the agarose packed The column was washed twice ... ·) Rabbit antibody to PrxII and an Alexa-647-labeled goat antirabbit IgG secondary were used to visualize PrxII Mouse monoclonal antibody to HA and an Alexa 488-labeled goat anti-mouse secondary...

9
401
0

Tài liệu Báo cáo khoa học: "Archivus: A multimodal system for multimedia meeting browsing and retrieval" doc

Ngày tải lên : 20/02/2014, 12:20

... Miroslav Melichar, and Martin Rajman 2005 A Framework for Rapid Multimodal Application Design In V´ clav Matouˇek, Pavel Mautner, a s and Tom´ s Pavelka, editors, Proceedings of the 8th a International ... can compare if the enforcement of certain modalities has an impact on how they choose to use language when all modalities are available On the backend, the wizards can also to some extent have ... implementation The dialogue manager contains only linguistic knowledge and interaction algorithms Domain knowledge is stored in an SQL database and is accessed by the dialogue manager based on...

4
395
0

Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " ppt

Ngày tải lên : 21/02/2014, 10:20

... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A ... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was ... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of...

5
396
1

Tài liệu BÁO CÁO " LIPID PRODUCTION FROM MICROALGAE AS A PROMISING CANDIDATE FOR BIODIESEL PRODUCTION " docx

Ngày tải lên : 21/02/2014, 10:20

... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A ... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was ... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of...

5
345
0