0

ecs and a model for quality control qc of extracellular protein folding

Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx

Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx

Báo cáo khoa học

... Cataract and a- crystallin mutations The mutation responsible for autosomal dominant congenital cataract, a common cause of infant blindness, localizes to the aA-crystallin gene (CRYAA) [60] An ... encourage cataract As a prelude to examination of protein recognition by modified a- crystallins, results obtained by mammalian two-hybrid analyses demonstrate that interaction of aA- and aB-crystallin ... a Nova Scotia Health Research Foundation ⁄ Canadian Institutes of Health Research Regional Partnership Plan Grant, and a Heart and Stroke Foundation of Nova Scotia Grant to THM and a NSHRF Student...
  • 15
  • 573
  • 0
Báo cáo khoa học: Functional similarities between the small heat shock proteins Mycobacterium tuberculosis HSP 16.3 and human aB-crystallin docx

Báo cáo khoa học: Functional similarities between the small heat shock proteins Mycobacterium tuberculosis HSP 16.3 and human aB-crystallin docx

Báo cáo khoa học

... presence and absence of ATP on the aggregation of CS In the absence of added MTB HSP 16.3, aggregation of CS increased after a short delay to reach a maximum after approximately 25 at 45 °C Ó ... Sherman for the kind gift of the monoclonal antibody IT-4 (a- 16 kDa), and S Yarfitz for technical assistance with the Multalin Sequence alignment program We also thank J Clark and C Ganders for ... with and without ATP over a 30-min period The aggregation of CS was measured with the addition of different concentrations of MTB HSP 16.3 and in the presence or absence of ATP and ATP analogs (A) ...
  • 8
  • 310
  • 0
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

Báo cáo khoa học

... prevention of nonspecific aggregation of partially denatured actin that can trap intact actin The 3D mutant prevents aggregation and by this means increases the quantity of available actin monomers and ... polymerization of intact actin and aggregation of heated actin Interaction of HSP25 with intact actin Fig Effect of heating on the kinetics of polymerization (A) and saltinduced increase of the ... the appearance of an additional peak at 7.65 mL on the elution profile Increase of the temperature of incubation was accompanied by the simultaneous increase of the peak eluted at 7.65 mL and...
  • 10
  • 431
  • 0
Báo cáo khóa học: Chaperone activity of cytosolic small heat shock proteins from wheat pptx

Báo cáo khóa học: Chaperone activity of cytosolic small heat shock proteins from wheat pptx

Báo cáo khoa học

... or has a more nonglobular shape Finite element analysis of the data [28] estimates a molecular mass of 201 kDa for TaHsp16.9C-I and 173 kDa for TaHsp17.8C-II These data are consistent with a more ... initial heatinactivation step Data points and error bars reflect the mean and standard deviation of three replicates Results Comparison of TaHsp16.9 C-I and TaHsp17.8 C-II To produce recombinant ... extended shape for TaHsp16.9C-I than for TaHsp17.8C-II and with a dodecameric organization for TaHsp16.9C-I and an oligomer of TaHsp17.8C-II containing 9–10 monomer units These data are in good agreement...
  • 11
  • 386
  • 0
Báo cáo khoa học: Temperature and concentration-controlled dynamics of rhizobial small heat shock proteins doc

Báo cáo khoa học: Temperature and concentration-controlled dynamics of rhizobial small heat shock proteins doc

Báo cáo khoa học

... concentration, and that mutant proteins equivalent to HspH(G11 4A) form unstable complexes Materials and methods Bacterial strains and plasmids Escherichia coli DH 5a, grown in LB (Luria–Bertani) medium, was ... T., Sasamoto, S., Watanabe, A. , Idesawa, K., Iriguchi, M., Kawashima, K., Kohara, M., Matsumoto, M., Shimpo, S., Tsuruoka, H., Wada, T., Yamada, M & Tabata, S (2002) Complete genomic sequence of ... the control sample (B) and the heat-treated sample (C) was collected, precipitated, separated by SDS-PAGE and stained with Coomassie blue Lanes and correspond to the peak that eluted at around...
  • 10
  • 289
  • 0
Báo cáo khoa học: Mimicking phosphorylation of the small heat-shock protein aB-crystallin recruits the F-box protein FBX4 to nuclear SC35 speckles docx

Báo cáo khoa học: Mimicking phosphorylation of the small heat-shock protein aB-crystallin recruits the F-box protein FBX4 to nuclear SC35 speckles docx

Báo cáo khoa học

... methanol, without prior permeabilization, and treated with DNase I (a c) or RNase A (d–f) Cells were costained with the RIKEN mAb anti-(aB-crystallin) (a and d) and YOYO-1 (b) or anti-Sm (e) Panels ... a1 -adrenergic antagonist J Biochem (Tokyo) 117, 1238–1243 Kato, K., Goto, S., Inaguma, Y., Hasegawa, K., Morishita, R & Asano, T (1994) Purification and characterization of a 20-kDa protein that is highly ... mutation in the aB-crystallin chaperone gene causes a desmin-related myopathy Nat Genet 20, 92–95 Sawada, K., Agata, K., Yoshiki, A & Eguchi, G (1993) A set of anti-crystallin monoclonal antibodies...
  • 9
  • 381
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học

... 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E19 9A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E20 4A ... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E19 0A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E19 0A, 5¢-CAAATTGGGGG ... thyroglobulin (mass of 669 kDa) and apoferritin (mass of 443 kDa) (Fig 4), with an average molecular mass of 613 ± 185 kDa, as calculated from the standard curve (not shown), corresponding to an average...
  • 14
  • 417
  • 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học

... 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ ... The expanding family of Arabidopsis thaliana small heat stress proteins and a new family of proteins containing a- crystallin domains (Acd proteins) Cell Stress Chaperones 6, 225–237 Narberhaus F ... work was supported by a Natural Sciences and Engineering Research Council of Canada Discovery Grant, a Nova Scotia Health Research Foundation ⁄ Canadian Institutes of Health Research Regional Partnership...
  • 15
  • 515
  • 0
Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx

Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx

Báo cáo khoa học

... both at neutral [32] and alkaline pH [33], the wild-type HSP22 and its mutants migrated as a single band with an apparent molecular mass of approximately 60 kDa (data not shown), thus indicating ... supernatant was used as the starting material for HSP22 purification Ammonium sulfate was added to the supernatant up to a final concentration of 0.3 m and the sample obtained was loaded onto a mL ... the same time, the K137E mutant of HSP22 was eluted as a broad peak with a trailing end, with a Stokes radius and apparent ˚ molecular mass of 28.2 A and 43.9 kDa, respectively (Fig 3A) Taking...
  • 15
  • 431
  • 0
Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc

Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc

Báo cáo khoa học

... different circumstances and that they are capable of interacting with each other The physical and functional interactions may therefore provide another layer of control for HSF-mediated transcription ... M, Hayashida N, Katoh T, Oshima K, Shinkawa T, Prakasam R, Tan K, Inouye S, Takii R & Nakai A (2010) A novel mouse HSF3 has the potential to activate nonclassical heat-shock genes during heat ... C-terminal activator domain in yeast heat shock factor: independent control of transient and sustained transcriptional activity EMBO J 12, 5007–5018 35 Nakai A, Tanabe M, Kawazoe Y, Inazawa J, Morimoto...
  • 14
  • 549
  • 0
Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt

Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt

Báo cáo khoa học

... Japan) Images were recorded with a MegaviewII numeric camera, and analysis software (Soft Imaging System GmbH, Munster, Germany) ¨ was used to analyze the images Determination of intracellular ... from Dalhousie University, Halifax, Canada and held a CIHR ⁄ CNRS International Scientific Exchange Scholarship from the Canadian Institutes of Health Research and the Centre National de la Recherche ... more repeats are toxic and precipitate as insoluble fibers in affected neurons [8] In human and HD transgenic mice, the disease correlates with the appearance of intraneuronal, intranuclear and perinuclear...
  • 18
  • 721
  • 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Báo cáo khoa học

... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... excised and purified with the GFXTM PCR DNA and Gel Band Purification Kit (AmershamPharmacia Biotech) Each p26 cDNA was ligated into pET21(+) using T4 DNA ligase, and competent E coli DH 5a were transformed...
  • 10
  • 495
  • 0
Báo cáo khóa học: Some properties of human small heat shock protein Hsp20 (HspB6) potx

Báo cáo khóa học: Some properties of human small heat shock protein Hsp20 (HspB6) potx

Báo cáo khoa học

... was accompanied by a significant decrease of molecular mass The molecular mass of a- crystallin that was not subjected to urea treatment was > 900 kDa, whereas after urea treatment and renaturation ... or greater than that of commercial a- crystallin At pH 7.0, the heating of isolated ADH in the absence of divalent cations was accompanied by aggregation and a large increase in the light scattering ... an increase of the lag period and a decrease in the amplitude of light scattering Significant retardation of the insulin B-chain aggregation was observed at an insulin/Hsp20 ratio of : At a mass...
  • 12
  • 372
  • 0
Báo cáo khoa học: Small heat shock protein Hsp27 prevents heat-induced aggregation of F-actin by forming soluble complexes with denatured actin docx

Báo cáo khoa học: Small heat shock protein Hsp27 prevents heat-induced aggregation of F-actin by forming soluble complexes with denatured actin docx

Báo cáo khoa học

... real-time correlator Photocor-FC dynals software (Alango, Tirat Carmel, Israel) was used for polydisperse analysis of DLS data The mean hydrodynamic radius of the particles, Rh, was calculated ... Stable complexes of small HSP with denatured actin A V Pivovarova et al of 42 kDa An important feature of actin is its ability to polymerize upon addition of neutral salts, with formation of ... smaller than the corresponding values for native actin filaments or actin aggregates formed upon thermal denaturation of F-actin in the absence of Hsp27-3D Analytical ultracentrifugation of the Hsp27-3D...
  • 12
  • 319
  • 0
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx

Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx

Báo cáo khoa học

... N-terminal extension G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ ... ⁄ Canadian Institutes of Health Regional Partnership Plan Grant, and a Heart and Stroke Foundation of Nova Scotia Grant to THM YS was the recipient of a NSHRF Student Fellowship FEBS Journal ... 11222–11228 11 Sun Y, Mansour M, Crack JA, Gass GL & MacRae TH (2004) Oligomerization, chaperone activity, and nuclear localization of p26, a small heat shock protein from Artemia franciscana J Biol Chem...
  • 14
  • 358
  • 0
Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot

Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot

Báo cáo khoa học

... principles of a- Hsp assembly and the relation between complex formation and chaperone activity, we constructed a series of truncated and point-mutated a- Hsp variants A total of 19 a- Hsp derivatives ... oligomerization principles of bacterial a- Hsp proteins have received little attention Available data indicate that a- Hsp proteins from prokaryotes and plants may differ significantly from their mammalian ... HspE and HspH) and two class B proteins (HspC and HspF), as well as the class A E coli proteins IbpA and IbpB A representative example Ó FEBS 2002 from each class, A (HspH) and B (HspF), was chosen...
  • 9
  • 467
  • 0
báo cáo khoa học:

báo cáo khoa học: "Heat-shock proteins in infection-mediated inflammation-induced tumorigenesis" potx

Báo cáo khoa học

... chronic atrophic and nonatrophic gastritis, before and after eradication Helicobacter 2003, 8:503-512 Yamaoka Y, Kita M, Kodama T, Sawai N, Kashima K, Imanishi J: Induction of various cytokines and ... Z: Inflammation and cancer Nature 2002, 420:860-867 Mantovani A, Allavena P, Sica A, Balkwill F: Cancer-related inflammation Nature 2008, 454:436-444 Srivastava P: Roles of heat-shock proteins ... peptide associated with heat-shock protein gp96 Lancet 2001, 357:528-529 Harimoto N, Shimada M, Aishima S, Kitagawa D, Itoh S, Tsujita E, Maehara S, Taketomi A, Tanaka S, Shirabe K, Maehara Y: The...
  • 10
  • 587
  • 1
Local induction of heat shock proteins using magnetic fluid hyperthermia for ocular neuroprotection in glaucoma

Local induction of heat shock proteins using magnetic fluid hyperthermia for ocular neuroprotection in glaucoma

Cao đẳng - Đại học

... Yamada, Minhong Jeun, Seongtae Bae and Yasushi Takemura, “Magnetic Characterization and Self-Heating of Various Magnetic Nanoparticles for Medical Applications” The 3rd IEEE International NanoElectronics ... Seongtae Bae, and Yasushi Takemura, “Self-Heating Evaluation and Magnetic Property of Different Size Magnetic Nanoparticles” 2nd ISAMMA, Sendai, Japan, (2010, 07) Asahi Tomitaka, Hiroki Kobayashi, ... Biomedical Applications” Journal of Magnetics 16(2), 164 (2011) Asahi Tomitaka, Hiroki Kobayashi, Tsutomu Yamada, Minhong Jeun, Seongtae Bae and Yasushi Takemura, “Magnetic Characterization and Self-heating...
  • 191
  • 205
  • 0
Immunomodulatory roles of heat shock proteins

Immunomodulatory roles of heat shock proteins

Tổng hợp

... discovery of the role of HSPs in cancer immunity, particularly in the processing and cross-presentation of antigen [Srivastava and Amato, 2001; Srivastava et al., 1998; Srivastava, 1993; Srivastava and ... James and Sean from the AHU, and Ms Huang C-H from Prof Chua KY’s lab, for their help in the animal studies To Karen, Weiping and Huang Bo, for their assistance in DNA sequencing To Dr Lu and Jason, ... wells at appropriate final concentrations GM-CSF was added to a final concentration of 20 ng/mL The cells were incubated for 16 h at 37 °C The supernatants were harvested and assayed for TNF-α and...
  • 152
  • 547
  • 0
Báo cáo y học:

Báo cáo y học: "Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line" pptx

Báo cáo khoa học

... duplexes purchased from Ambion (Austin, TX) The coding strand for PARP-1 siRNA was 5’-AUG UCG GCA AAG UAG AUC CCU UUC C-3’ An unrelated siRNA sequence (catalog number 12935-113) was used as a control ... shock and evaluated DNA binding of HSF1 by EMSA After heat shock, both naïve and non-target siRNA transfected cells demonstrated comparable DNA binding activity of HSF-1 Using EMSA, we found that ... transcriptionally active euchromatin structures It has also been proposed that PARP-1 is part of a nucleosome complex along with a histone variant macroH 2A (mH 2A) At baseline conditions, mH 2A and...
  • 9
  • 279
  • 0

Xem thêm