ebook synopsis of some genera of the large pyrenomycetes by c g lloyd

Synopsis of Some Genera of the Large Pyrenomycetes doc

Synopsis of Some Genera of the Large Pyrenomycetes doc

Ngày tải lên : 28/06/2014, 19:20
... version SYNOPSIS OF SOME GENERA OF THE LARGE PYRENOMYCETE CAMILLEA THAMNOMYCES ENGLEROMYCES By C G LLOYD CINCINNATI, OHIO, JANUARY, 1917 THE GENUS CAMILLEA The receipt of a nice specimen of Camillea ... The Project Gutenberg eBook, Synopsis of Some Genera of the Large Pyrenomycetes, by C G Lloyd This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever ... may copy it, give it away or re-use it under the terms of the Project Gutenberg License included with this eBook or online at www.gutenberg.org Title: Synopsis of Some Genera of the Large Pyrenomycetes...
  • 101
  • 326
  • 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot

Ngày tải lên : 07/03/2014, 05:20
... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L -C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG ... 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG To overexpress N-terminal hexahistidine-tagged CcCac1L-N (His-CcCac1L-N) and CcCac1L -C (His-CcCac1L -C) , E coli BL21 cells (DE3) (Novagen) carrying the expression ... between the truncated mutants of CcCac1L and CcLim15 was confirmed by b-galactosidase assays, which demonstrated a higher binding affinity of CcCac1L-N than CcCac1L -C to CcLim15 (Fig 1D) Characterization...
  • 10
  • 487
  • 0
Báo cáo khoa học: Structural characterization of the large soluble oligomers of the GTPase effector domain of dynamin potx

Báo cáo khoa học: Structural characterization of the large soluble oligomers of the GTPase effector domain of dynamin potx

Ngày tải lên : 23/03/2014, 11:20
... pGEX4T1 vector by the QuickChange method (Stratagene, La Jolla, CA) using the oligonucleotides I697A-f 5¢-GATTAATAATACCAAGGAGTTCGCCTTC TCGG-3¢ and I697A-r 5¢-CCGAGAAGGCGAACTCC TTGGTATTATTAATC-3¢ ... forces governing the association of the helices in the core of the oligomer, we calculated the electrostatic potential of the surfaces of the two long helical segments predicted from the above algorithms; ... core of the oligomers Because of the large size of the core of the oligomer, the NMR spectra not show any signals from the 392 interior of the core and thus not give any information on its structural...
  • 10
  • 370
  • 0
Báo cáo khóa học: Three cyclin-dependent kinases preferentially phosphorylate different parts of the C-terminal domain of the large subunit of RNA polymerase II potx

Báo cáo khóa học: Three cyclin-dependent kinases preferentially phosphorylate different parts of the C-terminal domain of the large subunit of RNA polymerase II potx

Ngày tải lên : 23/03/2014, 12:20
... directly compare the phosphorylation of the CTD or synthetic CTD derivatives by CDK7/CycH/MAT1, CDK8/CycC and CDK9/ CycT1 [25,27–31] CDK7/CycH/MAT1 and CDK8/CycC preferentially phosphorylate the S5 ... subcloning the human CycH into pBlueBac (Invitrogen) and transfecting Sf9 cells according to the instructions of the manufacturer The baculovirus containing His6-CDK8 was produced by subcloning ... and the corresponding enzymes could have additional effects on the substrate specificities of CDK7/CycH/MAT1, CDK8/CycC and CDK9/CycT1 These effects are beyond the scope of the current study The...
  • 11
  • 389
  • 0
The Project Gutenberg eBook, History of the American Clock Business for the Past Sixty Years pdf

The Project Gutenberg eBook, History of the American Clock Business for the Past Sixty Years pdf

Ngày tải lên : 28/06/2014, 17:20
... out a cargo; ridiculed by other clock makers; prejudice of English people against American manufacturers; how they were introduced; seized by custom house officers; a good joke; incidents; the ... again; cottton [sic.] cloth $1 per yard; the cold summer of 1816; a hard job; work at clocks CHAPTER II.—EARLY HISTORY OF YANKEE CLOCK MAKING.—Mr Eli Terry the father of wood clocks in Connecticut; ... CHAPTER VIII. THE METHOD OF MANUFACTURING THE JEROME MANUFACTURING COMPANY.— Benefit of manufacturing by system; a clock case for eight cents; a clock for seventy-five cents; thirty years ago and today;...
  • 292
  • 421
  • 0
The Project Gutenberg EBook of The Busie Body, by Susanna Centlivre ppt

The Project Gutenberg EBook of The Busie Body, by Susanna Centlivre ppt

Ngày tải lên : 28/06/2014, 17:20
... touch the Colors with an English Pencil, and form the Piece according to our Manners." Of course her touching the "Colors with an English Pencil" meant changing the style of Molière to suit the ... opening seasons and for long runs by great actors The text here reproduced is from a copy of the first edition now in the library of the University of Michigan Jess Byrd Salem College THE BUSIE ... that Council, which at this Critical Juncture, over-rules the Fate of all Europe But then I was encourag'd by Reflecting, that Lelius and Scipio, the two greatest Men in their Time, among the...
  • 291
  • 300
  • 0
The Project Gutenberg EBook of The Copeland Method, by Vanness Copeland doc

The Project Gutenberg EBook of The Copeland Method, by Vanness Copeland doc

Ngày tải lên : 28/06/2014, 17:20
... in, and making the cloth sweat The face to brush the nap of cloth, thereby refreshing the garment, making it look like new THE SPONGE CLOTH A sponge cloth is made of heavy unbleached cotton, one ... should be of the best and purest, when used for cleaning purposes The secret of success in cleaning, is by dipping the garment in a large quantity of the liquid Not less than a gallon of gasolene, ... of the cloth.) The brush is used to brush garments thoroughly before cleaning and is used in connection with the pressing of garments, to slap with the back the part pressed, thereby keeping the...
  • 226
  • 312
  • 0
The Project Gutenberg EBook of The Early Bird, by George Randolph Chester pptx

The Project Gutenberg EBook of The Early Bird, by George Randolph Chester pptx

Ngày tải lên : 28/06/2014, 17:20
... I send for McComas Here, boy, hunt Mr McComas and ask him to come out on the porch." The new guest was reaching for pencil and paper as they gathered their chairs together The two girls had already ... mischievousness Becoming conscious of his consciousness of her, he cast her deliberately out of his mind and concentrated upon Mr Stevens The two men gazed quite steadily at each other, not to the point of ... The Project Gutenberg EBook of The Early Bird, by George Randolph Chester This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever You may copy it, give...
  • 448
  • 360
  • 0
The Project Gutenberg EBook of Birds of the Indian Hills, by Douglas Dewar ppt

The Project Gutenberg EBook of Birds of the Indian Hills, by Douglas Dewar ppt

Ngày tải lên : 28/06/2014, 19:20
... house-crow is replaced by the deeper note of the corby Instead of the crescendo shriek of the koel, the pleasing double note of the European cuckoo meets the ear For the eternal coo-coo-coo-coo of ... source Beyond the junction the path to the glacier crosses to the left bank of the Pindar, and then the ascent becomes steep During the ascent the character of the flora changes Trees become fewer ... Himalayas is the large all-black species which is known as the Indian corby or jungle crow (C macrorhynchus) Unlike its grey-necked cousin, this bird is not a public nuisance; nevertheless it occasionally...
  • 513
  • 371
  • 0
Báo cáo y học: " Acute pseudo-obstruction of the large bowel with caecal perforation following normal vaginal delivery: a case report" pdf

Báo cáo y học: " Acute pseudo-obstruction of the large bowel with caecal perforation following normal vaginal delivery: a case report" pdf

Ngày tải lên : 11/08/2014, 12:20
... Gross specimen of ascending colon with perforation Ogilvie's syndrome following normal vaginal delivery in the English literature, the histological findings of the caecum after right hemicolectomy ... Authors' contributions DC and MS identified the case and gathered research in the form of literature reviews DC gathered the investigation results including the figures used in the manuscript DC wrote ... and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Competing interests The authors declare that they have no competing interests...
  • 3
  • 261
  • 0
Báo cáo y học: "Extension of the PNA world by functionalized PNA monomers eligible candidates for inverse Diels Alder Click Chemistyr"

Báo cáo y học: "Extension of the PNA world by functionalized PNA monomers eligible candidates for inverse Diels Alder Click Chemistyr"

Ngày tải lên : 26/10/2012, 08:57
... by Atherton and Sheppard.[40] Synthesis of the Fmoc -C2 -glycine-tert-butyl ester The synthesis of the peptide nucleic acid backbone requires the introduction of protecting groups as shown in the ... which could restrict the ligation efficiency The ligation begins with chemical reaction of the Reppe anhydrides cyclobutene, the dienophile with the highest reactivity After the reaction was complete, ... for intravital ligation of components With respect to reaching high local concentrations of diagnostics in cells for molecular imaging and specific therapeutically active molecules, PNAs are powerful...
  • 11
  • 503
  • 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

Ngày tải lên : 18/12/2013, 10:08
... the habits of racism, because we cannot carry the message of freedom and the baggage of bigotry at the same time (82) From the perspective of a single day, including this day of dedication, the ... lies in the remainder of the clause Normally, the choice of Theme reveals the meaning of the clause, more particularly the thematic meaning that clause conveys Theme/Rheme has relations to the notion ... impossible to give without considering the world at large: the context. Context of culture Context of situation TEXT Figure 1.1: Theory of context of situation Cook, in the same study of language in...
  • 44
  • 578
  • 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Ngày tải lên : 14/02/2014, 19:20
... in cerebellar granule cells The KIND2-1 core region was localized to dendrites, as was the endogenous v-KIND (Fig S3), indicating that the MAP2-binding core confers the dendritic targeting of ... MAP2-binding core module is important for dendrite growth of hippocampal neurons To clarify the biological significance of the v-KIND MAP2-binding core module, we generated full-length vKIND containing the ... overexpression of v-KIND, but similar to the effect of knockdown of v-KIND [12], thereby suggesting that the 32 amino acids core polypeptide acts as a dominant-negative molecule by competing with endogenous...
  • 11
  • 658
  • 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21
... in the rate of interaction with factor Xa brought about by the heparin pentasaccharide-mediated conformational change occurs through a combination of the changes in the structure of the RCL, ... from the A b-sheet by a closing of the sheet caused by a conformational transition in the molecule following the binding of a speci c heparin pentasaccharide sequence to a highly positively charged ... takes place [8] Both of these result in the irreversible inactivation (generally) of the serpins, and, in the case of the anticoagulant serpins, a lowering of the effective concentration of the serpins...
  • 10
  • 668
  • 0
Tài liệu Báo cáo Y học: Regulation of transcription of the Dnmt1 gene by Sp1 and Sp3 zinc finger proteins doc

Tài liệu Báo cáo Y học: Regulation of transcription of the Dnmt1 gene by Sp1 and Sp3 zinc finger proteins doc

Ngày tải lên : 22/02/2014, 07:20
... primers that corresponded to the cis-element (nucleotides )220 to +79), namely, 5¢-AAGGCTAGCCAGAGTCA TCCTCTGC-3¢ (forward direction) and 5¢-GCGCTCG AGCTTGCAGGTTGCAGAC-3¢ (reverse direction) PCR was ... nucleotide sequences of these ODNs were compared and the consensus-binding site was defined as the 15-bp sequence 5¢-GGCAAGGGGGAGGTG-3¢ (Fig 2B), which we designated the GA motif To examine whether or ... anti-Sp3 Ig confirmed these results (Fig 3A) The GA motif is different from the typical sequence of Sp1-binding sites, GGGCGG (Fig 2) Thus, Sp1- and Sp3-binding sites might be affected by sequences...
  • 10
  • 563
  • 0
The pollution of the marine environment by plastic debris: a review pptx

The pollution of the marine environment by plastic debris: a review pptx

Ngày tải lên : 06/03/2014, 23:20
... particles in the stomachs of of the 11 seabird species caught as bycatch The list of affected species indicates that marine debris are affecting a significant number of species (Laist, 1997) It affects ... regurgitate such materials which accumulate in their stomachs, becoming a significant source of mortality, as 90% of the chicks surveyed had some sort of plastic debris in their upper GI tract ... plastics reduce meal size by reducing the storage volume of the stomach and the feeding stimulus He concluded that seabirds with large plastic loads have reduced food consumption, which limits their...
  • 11
  • 1.1K
  • 0
Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx

Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx

Ngày tải lên : 07/03/2014, 03:20
... cysteine G1 Aa Cell extract Medium D Liang et al Aa 1 9C G2 G4 G1 G2 G4 Role of the C- terminal cysteine Ab G1 Ab 1 9C G1 G2 G4 G4 G2 G3 G6 Ba Ba 1 9C G4 BChE activity (arbitrary units) G2 G1 G4 G1 Bb ... and secretion of AChE and BChE Ab N1 9C M22V Ab N1 9C G1 G1 cell extract medium G2 G4 G4 G6 G2 G3 G6 Ab N1 9C D23H Discussion The C- terminal t peptides not influence cholinesterase activity G1 G2 Bb ... N1 9C M22V D23H G1 G1 G4 G2 G6 G3 G2 G6 Ab N18S N1 9C G1 G4 G3 G2 G6 Ab N18S N1 9C M22V D23H G1 BChE activity (arbitrary units) AChE activity (arbitrary units) G4 Ab N1 9C M22V D23H Bb N18S N1 9C G1 ...
  • 15
  • 446
  • 0
Báo cáo khoa học: Interaction analysis of the heterotrimer formed by the phosphatase 2A catalytic subunit, a4 and the mammalian ortholog of yeast Tip41 (TIPRL) ppt

Báo cáo khoa học: Interaction analysis of the heterotrimer formed by the phosphatase 2A catalytic subunit, a4 and the mammalian ortholog of yeast Tip41 (TIPRL) ppt

Ngày tải lên : 07/03/2014, 05:20
... (one cDNA), PP2Acb (three cDNAs), the C- terminal region of PP2Aca ⁄ b (one cDNA), PP 4c (three cDNAs) and PP 6c (two cDNAs) Initial mapping of the region of PP2Ac involved in TIPRL binding was ... in the clones containing lexA– TIPRL and the catalytic subunit of the phosphatases fused to the GAL4 activation domain (Fig 1B), indicating speci c interactions between TIPRL and PP2A catalytic ... PP2Acα PP2Acβ α β I B I PP 4c B I B PP 6c I PP2AcCT B I B GST I B Anti-His GST fusion: PP2Acα/β αβ PP 6c PP 4c PP2AcCT Coomassie stained gel GST B Inp ut GS T GS PP T2A c Bound AntiTIPRL TIPRL GSTPP2Acα...
  • 14
  • 419
  • 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Ngày tải lên : 07/03/2014, 21:20
... 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined); PSAG with a C- terminal Strep-tag (PSI -G- StrepTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ ... TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ ... GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CATTTTTCGAACTGCGGGTGGCTCCATCCAAAGAA GCTTGGGTCGTAT-3¢ (region encoding the Strep-tag, WSHPQFEK [19], underlined) Constructs containing a His- or Strep-tag in the...
  • 9
  • 422
  • 0
Báo cáo khoa học: Mechanism of the reaction catalyzed by dehydroascorbate reductase from spinach chloroplasts doc

Báo cáo khoa học: Mechanism of the reaction catalyzed by dehydroascorbate reductase from spinach chloroplasts doc

Ngày tải lên : 08/03/2014, 08:20
... for C9 S /C2 6S, P1, P2, P3 and P5 The oligonucleotide primers sequences used in PCR were as follows: P1, 5¢-AGCTTGTTGGGGGTGGT GAC-3¢; P2, 5¢-AATCTGTCACCACCCCCAAC-3¢; P3, 5¢-CCTTGACGGATATTTGGAGTG-3¢; ... 5¢-TGGCG ATTCTCCATTTTGCCAAAGAGTG-3¢; and P5, 5¢-TG GCGATTGTCCATTTTCCCAAAGAGTG-3¢ Mutated bases are underlined The PCR products were phosphorylated and self-ligated After mutation of DHAR, the ... bi-uni-uni-uni-ping-pong and uni-uni-bi-uni-ping-pong [23] By replotting the slopes and the intercepts with the y-axis of the lines in Fig against the reciprocals of the concentrations of the substrates (Fig...
  • 8
  • 354
  • 0

Xem thêm