e mailing selected text with a bookmarklet in internet explorer
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
... squares) the absolute level of labelled glutamine in the cells again remained higher when administered from the basolateral side, but steady-state levels were not yet reached Short exposure times ... in differentiation [40] When cells become more differentiated, we observed a decrease in glutamine uptake across the basolateral membrane This decrease may parallel changes in membrane composition, ... inserts are exposed to external glutamine from the apical or the basolateral side, we were able to investigate the in uence of the polarity on cellular glutamine uptake and glutamine incorporation into...
- 15
- 506
- 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt
... 1}, where the modulus u may be fixed or grow at a moderate rate as a function of x Estimates with these A are given in [16] One example which we shall examine in this paper is when A is a set of ... integers In the extreme case where (y, z] contains no squarefree integers, clearly H ∗ (x, y, z) = A theorem of Filaseta and Trifonov [13] implies that there are ≥ (z − y) squarefree numbers in (y, ... represents the typical case and is the origin of the exponent ν(r) + appearing in Lemma 3.4 and Theorem Proof We apply induction on f , the case f = being trivial Assume the statement is true...
- 68
- 409
- 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... Phe700 fi Ala reverse Phe718 fi Ala forward Phe718 fi Ala reverse Val736 fi Ala forward Val736 fi Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC ... used as biotinylated ligands Every point is an average of three or more independent experiments The continuous line represents fitting of experimental data using a single class of equivalent binding ... apparent KD values measured with our ‘two-step’ biotin enzymelinked streptavidin approach are in full agreement with those measured with an independent and accurate technique such as SPR, whose reliability...
- 15
- 337
- 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)
... Studies years years years years Math* years years years years Lab Science** years years years years Foreign Language years years years years Academic Electives years years years years * selected ... college graduates regardless of their academic backgrounds are rarely seen, and the world seems to get more and more specialized and require greater and greater focus and preparation from college ... curricula requirements all appear on the college Web sites or are in their brochures and catalogs Almost every college will have a Web site, and they are usually found at www.collegename.edu (edu standing...
- 142
- 375
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
... vertex was marked by measuring the mid-point intersection between the nasion-inion and inter-aural lines Potential stimulus sites were marked on the cap Page of using the vertex as a reference ... Hz), with a minute delay between each set Within each set, TMS pulses were separated by seconds (50 seconds total at each time-point) Data Analysis The outcome measures for this experiment were: ... stimulation and RMT were determined The experimental design was structured in phases: baseline, training, and post-training measurements (Figure 2) Subjects were comfortably seated with the right arm...
- 8
- 432
- 0
Báo cáo hóa học: "Research Article Harnack Inequality for the Schrödinger Problem Relative to Strongly Local Riemannian p-Homogeneous Forms with a Potential in the Kato Class" potx
... Riemannian p-homogeneous forms; we define a suitable notion of Kato class of measures We assume that the potential is a measure in the Kato class and we prove a Harnack inequality (on balls that ... initially given by Kato [16] in the case of Laplacian and extended in [2] to the case of elliptic operators with bounded measurable coefficients Kato classes relative to a subelliptic Laplacian were ... a locality assumption; in the nonlinear case this does not hold in general and the existence and some easy properties of the measure energy density has to be assumed We recall now the definition...
- 19
- 326
- 0
A Woman with a mass in the liver pot
... biopsy gan cho thấy ung thư, lại neuroendocrine tumor (ung thư từ colon, vú : thường phải adenocarcinoma) Khi thấy neuroendocrine tumor, tách (a) well differentiated, hay moderately differentiated: ... differentiated: carcinoid tumor hay pancreatic endocrine tumor (b) poorly differentiated có lẽ từ phổi (small cell cancer) Case khó chỗ: (1) tìm poorly diff neuroendocrine carcinoma, tức thuộc small cell ... neuroendocrine carcinoma chạy tới gan, ch a dùng chemotherapy agents mà thường dùng cho ch a ung thư thấy phổi, tức dùng combination Carboplatin etoposide "first line" - Kinh nghiệm "small cell cancer...
- 4
- 249
- 0
Báo cáo toán học: "Combinatorial Games: Selected Bibliography with a Succinct Gourmet Introduction" pdf
... qualities of a very general appeal That helps maintain a steady in ux of research talents into the field and renders games a convenient media for communicating powerful ideas about general methods ... The boardfeel is the main ingredient which makes PlayGames interesting to play III Math Appeal Playgames, in addition to being interesting to play, also have considerable mathematical appeal This ... win? Here we have a large number of alternating existential and universal quantifiers rather than a single existential one We are looking for an entire subtree rather than just a path in the decision...
- 88
- 294
- 0
Báo cáo lâm nghiệp: "Productivity and cost of manual felling with a chainsaw in Caspian forests" pptx
... slope in the stump area, and slope between two harvested trees were entered into the general model for predicting felling time as significant variables, which can be applied in harvesting planning ... respectively Obviously, mechanical delays are the most frequent After the mechanical delays, operational delays were the most frequent In order to prevent a decrease in their efficiency and to reduce ... walk to tree, acquire, undercut, back cut Harvesting factors or operational variables for chainsaw felling measured in the field include distance to tree, tree species, diameter at breast height...
- 5
- 393
- 0
Báo cáo y học: "HLA-E gene polymorphism associates with ankylosing spondylitis in Sardinia" doc
... 5'-TGCGAGCTGGGGCCCGAC rs2074505: FOR: CACAGTGATGGCTTCACAGGC; REV: 5'-CCTATAGGAAGCCCTCTGAGAC; SEQ: CCCCCGCACCCCACAGGA rs2074503: FOR: GCACAAGAAACA GCACCAAA; REV: AGTGACACACCCATCCCATC; SEQ: AGGAAGCAAAGATGGGTCCC ... disease [14] From the data reported here, it seems unlikely that a HLA -E neighboring gene rather than HLA -E itself, could be the real factor contributing to the disease The data reported here ... studies performed in a Spanish and an Asian population reports an imbalance of KIR alleles between patients with AS and HLAB27-matched controls but these data have not been replicated in a further...
- 6
- 217
- 0
Báo cáo y học: "Tight perioperative glucose control is associated with a reduction in renal impairment and renal failure in non-diabetic cardiac surgical patients" ppsx
... Exclusion criteria were any surgery needing deep hypothermic circulatory arrest, as well as preoperative end-stage renal failure requiring hemodialysis All data were retrieved from patient files and from ... angiotensin-converting enzyme inhibitors and perioperative aprotinin administration and packed cell transfusion are represented in Table The preoperative use of angiotensin-converting enzyme inhibitors ... retrograde St Thomas solution in all cases The Aalst Glycemia Insulin Protocol in all patients was continued in the ICU until enteral feeding was started Preoperative variables needed for the additive...
- 12
- 245
- 0
Nonlinear vibration of a pendulum with a support in harmonic motion
... interested in finding out what happens close to resonance, that is to say when - is sm all, namely: - (5) = + (Jjd where A is a detuning parameter Let us introduce in equation (3) the variables a and ... are explained The am p litu d e - freq u en cy curves are p lotted for various va lu es of param eters and the stab ility of vib ration is in v estig a ted , '"he rotating m otion of the p e n d ... ergoes arbitrary rectilinear harm onic m o tio n is stu d ie d T he m ain atten tion is paid to th e resonant ca ses and the station ary vibrations T h e r e so n a n t co n d itio n s are explained...
- 9
- 337
- 0
báo cáo hóa học: " The health-related quality of life in rheumatoid arthritis, ankylosing spondylitis, and psoriatic arthritis: a comparison with a selected sample of healthy people" potx
... to examine the selfreported health status in patients with RA, AS and PsA, compared with a selected sample of health people Furthermore, we wanted to explore the associations between health status ... control allowing the patient to take advantage of a greater number of pain reducing modalities Our findings suggest that educational level may have a greater effect on mental health outcomes in AS and ... swollen joint count, erythrocyte sedimentation rate, and a general health assessment on a visual analog scale (VAS) [23] Disease activity in patients with AS and axial PsA was measured with the BASDAI...
- 12
- 466
- 0
báo cáo hóa học:" Quality of life in female myocardial infarction survivors: a comparative study with a randomly selected general female population cohort" pot
... varies between the variables because of missing values *Self reported at the time of the survey CAD: coronary artery disease; CK: creatinin kinase; PCI: percutaneous coronary intervention; CABG: ... significantly more pain and discomfort than did the general female population In fact, 25% of the female MI survivors experienced chest pain several times a week, and 8% experienced chest pain at least ... guidelines to patients Interpreting the relevance of QOL data to clinical practice can be challenging An interpretation of clinical relevance is always subjective, but comparison with a normative...
- 11
- 428
- 0
Báo cáo khoa học: " Low numbers of intestinal Shiga toxin-producing E. coli correlate with a poor prognosis in sheep infected with bovine leukemia virus" pps
... scores with poor health and low weight gain, among BLV-infected sheep 2) Repeated oral treatments with STEC were associated with increased percentages of B cells in peripheral blood, although treatment ... STEC carriage at BLV challenge may influence interferon-γ and/or interleukin 12-dependent pathways, known to correlate with resistance to BLV [12] STEC-associated weight gain in BLV-positive animals ... were associated with deteriorating health In the absence of BLV infection, low STEC scores were not associated with poor health STEC scores correlated with weight gain among the BLV-challenged...
- 5
- 248
- 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"
... maxillary bone and mainly in the premaxilla (90-98%) 7, they are often impacted (88,7%) and are often present in the palatine area8,9 The prevalence of multiple supernumerary teeth ranges from ... the presence of pathologic processes affecting the supernumerary teeth and/or the teeth of the normal series which erupted, retained or impacted 1, In cases where surgical therapy is recommended, ... and hereditary predisposition has also been investigated and suggested: most of the reported cases of hyperdontia are determined by multifactorial inheritance Batra, et al described a case of...
- 7
- 597
- 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... was used wherever the expected value was less than 5; a paired t-test was used to compare the pre- and post-treatment results of average pain scores and the ODI measurements at baseline versus ... into a closed space such as an intraarticular space or epidural space or over a nerve has not been appropriately evaluated Carette et al24 showed that patients responded similarly to an intraarticular ... Sarapin in each group were analyzed by comparing them to each other Subsequently, local anesthetic and steroid group were compared if there were no differences Intent-to-Treat-Analysis An intent-to-treat-analysis...
- 12
- 669
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... ceiling effect Once established, the setting remained constant for all the images acquired for all the ICC experiments Therefore, when all the parameters were fixed, only tissue staining intensities ... images by delimiting the cellular area of interest free hand, using predetermined criteria to define the region of interest The immune intensity of the cellular Vgf encompassing the L3-L5 regions ... quantitative ELISA assays; in B, Vgf content decreased as a function of progression of muscle weakness assessed by manual muscle testing revealing an increased number of affected muscle (segments)...
- 8
- 499
- 0
What To Do If Trapped In A Lift With A Dentist
... trainers pickled in bree A vague sense of inadequacy A perambulating hamster nailed to the knee of a disgruntled member of a select committee A piano where every single key has been replaced ... have a teleport bracelet I don't have a hover car I've never seen robot slaves or a titanium bra I don't have a time machine or a personal dinosaur farm I don't have my meals in a tablet or a ... to make you scared of everyone feel the fear as you succumb to their desire for fear and hate divide and rule so they create an enemy for everyone to be against so we become a nation scared to...
- 34
- 515
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose