dysphagia an abdominal ct scan with a water soluble contrast swallow reveals a complete bowel obstruction and a dilated lower small intestine
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx
Ngày tải lên :
08/03/2014, 09:20
... can be described as a random coil, with only a small population of local nonrandom structures Overall, these data indicate that bulk water is not suitable for high resolution conformational analysis ... spectra) were integrated with NMRView and were converted into upper distance bounds with the routine CALIBA of the program package DYANA [29] After discarding redundant and duplicated constraints, ... was dissolved in 120 lL of HFIP and 160 lL of an appropriate HFIP /water mixture were added cautiously, to give a final peptide concentration of approximately 80 lM and a water content between and...
- 7
- 624
- 0
Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf
Ngày tải lên :
30/03/2014, 09:20
... resonance of 4,4-dimethyl-4-silapentane-1-sulfonic acid used as an internal standard Distance restraints and structure calculations An initial survey of distance constraints was performed on a series ... added as target values of 2.2 A for NH(i)– ˚ for N(i)–O(j), respectively O(j) and 3.2 A One thousand random structures were generated by dyana (v 1.5) that fit the primary sequence and covalent and ... outcome was a set of 20 ˚ structures with a mean global rmsd of 0.56 ± 0.16 A and a ˚ mean global heavy atom rmsd of 1.30 ± 0.28 A Structural refinement was carried out using amber and structure quality...
- 7
- 346
- 0
an oh maser flare with a strong magnetic field in w75n
Ngày tải lên :
28/04/2014, 13:15
... have also been found near the OH masers in W75N, located in two clusters around VLA1 and VLA2 Torrelles et al (2003) have found a shell of water masers around the ultra-compact HII region VLA2 ... close to VLA2, at a distance of 55 mas (±40 mas), or at the projected distance of 110 AU (±80 AU) Therefore, the OH masers may well be located in the same shell as the water masers The magnetic ... maser features and the simultaneous dimming of nearby features can be interpreted as originating from the passage of a magnetohydrodynamic (MHD) shock (Alakoz et al 2005) The shock was probably...
- 2
- 250
- 0
phosphorene an unexplored 2d semiconductor with a high hole mobility
Ngày tải lên :
06/05/2014, 08:54
... by epitaxial mismatch with a substrate, will change phosphorene from a direct-gap to an indirect-gap semiconductor with a significantly smaller gap Details of the computational approach are listed ... e-beam evaporator at a rate of Å/s to define contact electrodes and metal gates No annealing has been performed after the deposition of the metal contacts The top gate dielectric material was deposited ... transfer curves for drain bias values Vds = 0.01 and 0.5 V, which indicate a current on/ off ratio of ∼104, a very reasonable value for a material with a bulk band gap of 0.3 eV We also note that,...
- 9
- 395
- 0
phosphorene an unexplored 2d semiconductor with a high hole mobility
Ngày tải lên :
06/05/2014, 08:58
... by epitaxial mismatch with a substrate, will change phosphorene from a direct-gap to an indirect-gap semiconductor with a significantly smaller gap Details of the computational approach are listed ... e-beam evaporator at a rate of Å/s to define contact electrodes and metal gates No annealing has been performed after the deposition of the metal contacts The top gate dielectric material was deposited ... transfer curves for drain bias values Vds = 0.01 and 0.5 V, which indicate a current on/ off ratio of ∼104, a very reasonable value for a material with a bulk band gap of 0.3 eV We also note that,...
- 9
- 541
- 0
báo cáo khoa học: "Long-term misuse of zopiclone in an alcohol dependent woman with a history of anorexia nervosa: a case report" pps
Ngày tải lên :
11/08/2014, 02:22
... anorexia nervosa and alcohol dependence Anorexia was first diagnosed in 1994, and when she was 17 years old she was treated as an inpatient By the age of 18 years, her problem with alcohol had ... burning Page of and lacerating; her last admission to Accident and Emergency was two years ago Her father died of alcohol-related problems and her uncles are also alcohol dependent Her sister had anorexia ... journal Authors’ contributions FK is the Consultant Psychiatrist on the AAU and AM is a Research Scientist (Pharmacology) AM interviewed the patient and wrote the manuscript Both authors read and...
- 4
- 272
- 0
Báo cáo y học: " New technical approach for the repair of an abdominal wall defect after a transverse rectus abdominis myocutaneous flap: a case report" pot
Ngày tải lên :
11/08/2014, 23:21
... movement and impairment of bowel function led to an explorative laparotomy and an attempt to reconstruct the abdominal wall Following adequate preparations with intestinal irrigation, a re-incision ... recovery was uneventful; during her hospital stay she wore an elastic abdominal belt and was provided with analgesics and physical therapy with intense respiratory training The suction drains and suture ... investigations and assisted in the literature search, writing and editing of the manuscript All authors have reviewed and approved the final manuscript 16 Rasim ZM, Alzahrani MA, Sigman HH, Meakins JL,...
- 6
- 427
- 0
Báo cáo y học: " Adenovirus serotype 7 associated with a severe lower respiratory tract disease outbreak in infants in Shaanxi Province, China" pps
Ngày tải lên :
11/08/2014, 21:21
... GCAAAAGCTGATATGACAG 19412-19430 4U CATTGGCTTCAGGGATAAC 19288-19306 4L TGGCGTGTACTTGTAAAC 19748-19765 5U GGCAACAATCTGGCTATG 19661-19678 5L GAGGTTGATGCTGGTGAA 20136-20153 6U TGGAAATGACCTCAGAAC ... 7U GAACCAGGAACCAGTCTT GTGGATGGGGAAGGATAC 20586-20603 20543-20560 506 7L TAAAGCAGGGTGGGCTCA 21031-21048 8U CATACCGTTCTCCAGCAACT 20914-20933 8L ATCAAAAAGGTAGCAGGT 21405-21422 9U CGCCATAGTCAACACTGC ... emergency and re-emergent disease Patients and Methods The index case was a one-year-old female from Xixiang County, Hanzhong, Shaanxi Province She had an onset on 15 January with an admission to Hanzhong...
- 7
- 271
- 0
Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt
Ngày tải lên :
12/08/2014, 18:20
... et al Critical Care 1998, 2:79 http://ccforum.com number of bacteria after hand-washing/the number of bacteria before hand-washing)] Values are calculated from raw data and expressed as mean ... importance of airborne and direct contact transmission of microrganisms in a medical intensive care unit J Hosp Infect 1990, 15:301-309 Graham M: Frequency and duration of hand washing in an intensive ... flow of water enhances the antiseptic effects of this system by washing away bacterial contamination and organic material, which would otherwise reduce the bactericidal effect In general, the...
- 2
- 450
- 0
Detection of an uncharged steroid with a silicon nanowire field effect transistor
Ngày tải lên :
16/03/2014, 15:23
... Chang et al / Sensors and Actuators B 138 (2009) 148–153 149 with HF solution After defining the contact pad patterns, a stack of Ti (10 nm) and Au (100 nm) was then evaporated with a thermal ... the calculated value 13,768 Da (13402 Da for Art KSI and 366 Da for mA51 moiety) (b) The structures of 1,5-EDANS, mA51 moiety and mA51-mA51 a film of SiO2 (thickness 30 nm) and surface modification ... 19-NA at various concentrations, the conductance of Art KSI/mA51-labeled SiNW-FET rapidly increased to a constant value [Fig 5(b)] 19-NA at a greater concentration resulted in a greater conductance,...
- 6
- 492
- 1
Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc
Ngày tải lên :
16/03/2014, 23:20
... Project for EST data and ´ cDNA material, and H Moreau (Observatoire Oceanologique de Banyuls, France) for granting us access to the Ostreococcus blast analysis References Lupas A, Flanagan JM, Tamura ... in green algae and vascular plants, i.e the green lineage of plants ClpP genes are also found in Cyanobacteria [22] and in the genome of the Cyanophora cyanelle, an ancestral chloroplast In the ... ClpP1 antibody The ClpP1H and ClpP1L bands decrease slowly and concomitantly after 24 h, indicating that both are stable in the cell As a loading control, a duplicate blot was reacted with an antibody...
- 14
- 436
- 0
Báo cáo sinh học: " Unusual presentation of hepatitis B serological markers in an Amerindian community of Venezuela with a majority of occult cases" doc
Ngày tải lên :
18/06/2014, 18:20
... Orinoco Delta (DELTA), in Yucpas (JAPREIRA) and in Yanomamis (Y) and Piaroas (P) from the Amazon (AMAZ) Figure HBV core variants circulating in a Piaroa Amerindian with OBI a Agarose gel electrophoresis ... cloureir@gmail.com Domingo J Garzaro,Aff2 Email: dgarzaro@gmail.com Mar a C Duarte,Aff1 Email: mcarolad@hotmail.com Daisy M Garc a, Aff1 Email: mayilag@hotmail.com Milian C Pacheco,Aff1 Email: milianp@hotmail.com ... isolate, BP21, exhibited co-circulation of a wild type virus along with a variant harboring a premature stop codon at aa 42 of the core protein, and a variant exhibiting a deletion of 28 aas (aa...
- 13
- 375
- 0
Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt
Ngày tải lên :
18/06/2014, 18:20
... parameters for tracer into and out of the cell, K1 and k2, the parameters for phosphorylation and dephosphorylation of intracellular tracer, k3 and k4, and the fractional blood volume, also called ... standard iterative method, the machine learning method has the advantage of a fast convergence and avoidance of over fitting [29] The model parameters were accepted when K1 − k4 was less than and ... presents the mean, median, minimum, and maximum values as well as the standard deviation for the SUV, FD, and kinetic values of all parameters for both tracers (Table 1) In the whole paper, B and R represent...
- 23
- 350
- 0
báo cáo hóa học: " Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 in APP-tg mice" ppt
Ngày tải lên :
19/06/2014, 22:20
... by the Harvard Standing Committee for Animal Use and in compliance with all state and federal regulations Immunization All peptides used in these studies, A 1–40, A 1–42, A 1– 15 and dAβ1–15, ... stored at -80°C for biochemical analysis of A Anti -A antibody ELISA Anti -A antibodies in plasma were measured by ELISA as previously described [30] ELISAs for antibody isotypes and epitope mapping ... supernatants using matching antibody pairs composed of a capture and detection antibody for IL-4 and IFN-γ (BD PharMingen) A ELISA Both soluble and insoluble brain A levels were determined For soluble...
- 10
- 398
- 0
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
Ngày tải lên :
20/06/2014, 04:20
... (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant acid phosphatase (TRAP) staining in order to demonstrate the osteoclasts Deparaffinized ... results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic ... the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that in the (MC-;...
- 10
- 478
- 0
Báo cáo hóa học: " Abdominal pain with a twist" docx
Ngày tải lên :
21/06/2014, 03:20
... first draft of the paper ST co-authored the first draft and reviewed all drafts and radiographic images TJ reviewed and commented on all the drafts of the paper and radiographic images All authors ... MA: Mesenteric vascular anatomy at CT: normal and abnormal appearances Radiology 1991, 179(3):739-42 Orzech N, Navarro OM, Langer JC: Is ultrasonography a good screening test for intestinal malrotation? ... (hyponatraemia and hyperkalaemia) and administration of broad-spectrum intravenous antibiotics Surgery is the treatment of choice as there is a high risk of vascular compromise and intestinal necrosis...
- 3
- 217
- 0
Báo cáo hóa học: " The prevalence of polypharmacy in elderly attenders to an emergency department - a problem with a need for an effective solution" doc
Ngày tải lên :
21/06/2014, 03:20
... the data; AB, DM, AAK and SE actively collected the data from the departmental records All the data have been verified by DM and AB Authors’ information Ashis Banerjee has been a consultant in ... 16 years, and is lead clinician at Chase Farm Hospital and honorary senior lecturer at University College London Medical School David Mbamalu is a consultant in emergency medicine at Chase Farm ... Farm Hospital, Enfield Sayed Ebrahimi and Arshad Ali Khan are specialty doctors in emergency medicine at Chase Farm Hospital, Enfield T.F Chan is chief pharmacist at Chase Farm Hospital, Enfield...
- 3
- 340
- 0