dynamic diagrams addresses the five uml diagrams that focus on the behavioral aspects of a system being modeled
The Behavioral Aspects of Smoking doc
... may have a very profound effect upon the heart and blood vessels of a nonsmoker The tachycardia may be perceived either as a pleasant or unpleasant sensation The cardiovascular changes associated ... nicotine attenuated the electrical stimulation and increased learning The suggestion is made that the nicotine-induced limbic system activation antagonized the behavioral disruption In Carruthers’ attempt ... Self-Reports There are many studies in the literature on incidence and prevalence of cigarette use and the evaluation of treatment efficacy Unfortunately, the analysis and conclusions are often based on...
- 201
- 498
- 0
Báo cáo hóa học: " Multiple-Clock-Cycle Architecture for the VLSI Design of a System for Time-Frequency Analysis" doc
... unconditional, no label is given Note that implementation of a finite-state machine usually assumes that all outputs that are not explicitly asserted are deasserted, and the correct operation of the architecture ... Editor of the IEEE Transactions on Image Processing He is a Member of the Yugoslav Engineering Academy, and a Member of the National Academy of Science and Art of Montenegro (CANU) Professor Stankovi´ ... units are realized by using combinational logic, meaning that all calculation operations are performed in parallel The schematic diagram of its FPGA implementation is given in Figure 12 As seen, there...
- 18
- 385
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... represents the first example of the effects of an antimicrobial peptide from frog skin on the proteome of bacteria, and demonstrates that the bacterial membranes are the major targets of its mechanism of ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... to allow one missed cleavage per peptide, a mass tolerance of 0.5 Da, and for carbamido-methylation of cysteines to be considered as a fixed modification and oxidation of methionines as a variable...
- 18
- 494
- 0
The introduction of a system that would improve a manager’s ability to successfully supervise their employees, operating companies has been identified as a solution
... application all business rules has been saved on the database and database with application saved on the server The applications for accessing the database on the server should be used the stored ... software was the ability of using the database Two tier applications have a same scenario with this content The name of this kind of the application is a client-server application In this type of application ... data from within the database A login system can also be created by using data in the database where the login details will be stored in the database and the system will validate the information...
- 31
- 448
- 0
Monitoring the macroeconomic determinants of banking system stability
... for the operation of the financial markets in general and the stability of the banking system in particular The spectacular expansion in the volume of financial transactions compared with that of ... for the balance of payments and foreign trade statistics Lastly, it is the Bank that draws up, on behalf of the National Accounts Institute, the national accounts data, not only for the financial ... examination of the effects which changes in financial conditions produce on the real part of the economy, largely via the process of transmission of monetary policy, the financial system has,...
- 21
- 593
- 1
The Marketing Strategy of a multinational join stock company.doc
... price of two-way air conditioners and lower installation and maintenance cost of air conditioner are the two key elements to increase the sales of a multinational join stock company’s air conditioners ... standardization, standardization is just one part of a global marketing strategy Consequently, striking the right balance between standardization and localization greatly contribute to a multinational join ... 5D The Marketing Strategy of a multinational join stock company Conclusion The first part of the thesis concepts related to marketing and the theory that will be later based on to research The...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
... ENUMERATION MEMBERS CONSTANT DESCRIPTION Cascade Indicates that the delete or update to the DataRow objects in the parent DataTable are also made in the child DataTable This is the default None ... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... Indicates that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which...
- 6
- 428
- 0
Tài liệu ITU Study on the Financial Aspects of Network Security: Malware and Spam doc
... review of the available research has demonstrated a wide range of estimates as to the potential financial impacts of malware and spam on participants in the information and communication value ... through the available data and to document the state of knowledge on the financial effects of malware and spam Where financial information is not available, we attempted to provide operational data ... installation and the other is manual installation Malware compromises the system and may download additional payload code to expand or update its functionality Once installed, new features and capabilities...
- 42
- 471
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... BIAEVALUATION 3.1 Table Dissociation constants and quantication of the destabilizing eect of the mutations on the interaction between mutant GAPDHs and CP12 The dissociation constants were measured ... mutation, suggesting that the active site and the cofactor-binding site of the mutant R19 7A are not modied by the mutation We thus assume that the conformation of the R19 7A mutant is close to that...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... Intelligence Advanced Research Projects Activity (IARPA), through the U.S Army Research Lab All statements of fact, opinion or conclusions contained herein are those of the authors and should not be construed ... of the National Academy of Sciences, 101 Weiwei Guo and Mona Diab 2010 Combining orthogonal monolingual and multilingual sources of evidence for all words wsd In Proceedings of the 48th Annual...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... (equal to unit of SOD activity under standard conditions) After incubation of aliquots at the required temperature or after addition of sodium azide at the required concentration, Vs was measured ... Beauchamp and Fridovich [42] Protein concentration Estimation of the concentration of purified protein or in the lysates was by the method of Bradford using BSA as standard [43] Protection against...
- 12
- 740
- 0
Camilla: A Tale of a Violin Being the Artist Life of Camilla Urso pdf
... alone in the alley-ways and lanes of the old city and invitations to play at the houses of some the grand families came in One of these was to the residence of Madam Armengo and another was the ... the attic and in the sixth story There was a broad balcony at the foot of the steep mansard roof and here Camilla's mother arranged a pretty row of plants in pots so that the iron railing in front ... was no longer a weariness to practice The weeks flew away so happily that they hardly noticed that the Fall was near They must return to Paris soon The vacation was over long ago Still, the handsome...
- 56
- 403
- 0
On the Control Aspects of Semiactive Suspensions for Automobile Applications doc
... On the Control Aspects of Semiactive Suspensions for Automobile Applications by Emmanuel D Blanchard Mehdi Ahmadian, Chairman Mechanical Engineering Abstract This analytical study evaluates the ... necessarily decrease with a reduced peak value of the acceleration It means that the measure of the vibration level & E[x ] cannot be deducted from the peak value of the acceleration It can be ... suspensions and active suspensions based on linear-full-state feedback control laws It is shown that an active suspension can result in a reduction of the rms acceleration of the sprung mass, i.e., a...
- 118
- 363
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... calculations indicate that Glu144 has a slightly elevated pKa in the free enzyme that, at least in part, results from the vicinity of Asp215 (Table 3, rows and 4) The calculations indicate that the ... and covalent bonds being formed and broken) Thus, the calculated effect of rotation of Asp142 on the pKa of Glu144 only gives an indication of what may happen to the acidity of Glu144 Although ... The pKa of Asp140 is much lower than that of Asp142 and Glu144 in all situations where all three residues are present and the one proton shared by Asp140 and Asp142 appears to remain on Asp142...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... to a sequence of production states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of ... analysing the results over two sets of data The first is a selection of data from CoNLL2004 and contains 8936 sentences The second dataset is part of the Lancaster Treebank corpus and contains 1473 ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the ... an extra barrier subsite There is also another study on the action pattern of barley enzyme including calculation of subsite affinities which was based on the Suganuma method [21] This calculation...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... in length and contains an 867-bp ORF, which encodes for a protein with 289 amino acids and a calculated molecular mass of 32 kDa A search of the nonredundant protein sequence database was performed ... negative) than the latter As the C-terminal region is rich in acidic amino acids, if it does have some interaction with the N-terminal domain, the mechanism of regulating the catalytic activity may be ... of thioredoxin and antioxidants on the activation of transcription factors NF-kappa B and AP-1 Proc Natl Acad Sci USA 91, 1672–1676 14 Spector, A. , Yan, G.Z., Huang, R.R., McDermott, M.J., Gascoyne,...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... effect of ADP As an increased ratio of ADP towards ATP signicantly inhibits Cl-ACL activity, we investigated the effect of ADP on the phosphorylation of AclA Addition of 10100 lM ADP to the phosphorylated ... prevented the degradation of AclA that was otherwise observed in the absence of AclB After the phosphorylation, we detected that the addition of citrate subsequently removed the phosphate from the ... in (A) (puried enzyme before subunit dissociation) and (B) (AclA alone) Molecular masses (kDa) are indicated on the left of the panel The asterisk indicates the degradation product of AclA described...
- 8
- 551
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
... inverse The increase of photon intensity of one mode makes the decrease of the one of other mode The reason perhaps is due to the conservation of energy in the operation of two-mode random microlaser ... operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation of mode photon densities With each parameter, its influence on two modes almost ... one of parameters in table and remain invariable all the rest of parameters The obtained results are shown in Section 3 Influences of laser parameters on saturated photon densities 3.1. Gain coefficients ...
- 4
- 343
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008