dynamic and quasi static simulation of a novel compliant mems force amplifier by matlab simulink
báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx
Ngày tải lên :
19/06/2014, 08:20
... supported in part by an Ontario Graduate Scholarship, Natural Sciences and Engineering Research Council of Canada and the Canada Research Chairs program The authors acknowledge Mr Ka Lun Tam for his ... the 1.2-2.5 range, and was adjusted for each participant such that false activations due to blinks and movement were avoided and participants were able to activate the switch by raising their ... signal is generated by the unfused mechanical activities of motor units The bulk movement of the muscle and asynchronous activation of fibers at the initiation and end of contraction creates a...
- 10
- 501
- 0
DESIGN AND CHARACTERISTICS OF a NOVEL COMPLIANT PLANAR SPRING CAPABLE OF a POSITIVE STIFFNESS FOR a COMPACT VIBRATION ISOLATOR THIẾT kế và đặc TÍNH của lò XO PHẲNG mềm mới CHO bộ TÁCH RUNG ĐỘNG
Ngày tải lên :
08/06/2016, 14:07
... the static and modal characteristics of the proposed spring A model of compact QZS vibration isolator is then constructed as an application of compliant mechanism Figure Diagram of a QZS isolator: ... design and analyze in this paper This paper aims to propose a design of novel compliant planar spring capable of a positive stiffness for the compact QZS nonlinear vibration isolator instead of utilizing ... fabricate, allowing for a monolithic manufacturing, and a minimal maintenance In contrast, in vibration isolator systems, there has been a little attention to the use of compliant mechanism Platus...
- 8
- 424
- 0
Design and Simulation of A CMOS-MEMS Accelerometer
Ngày tải lên :
27/10/2013, 23:15
... ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a total sensing capacitance of 60fF Parasitic capacitance and mismatch of ... finger gap, and the ratio of parasitic capacitance and sensing capacitance Since m, and d are limited by process technology, sensitivity is most effectively increased by adjusting k, and Vm As discussed ... are shown in Figure 2.9 The symmetric topology (Figure 2.9 (a) ) has the advantages of simplicity and less parasitic capacitance along with the disadvantage that a cross-axis acceleration signal...
- 40
- 588
- 1
Tài liệu Design And Simulation Of A Cmos-Mems Accelerometer doc
Ngày tải lên :
22/12/2013, 08:16
... ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a total sensing capacitance of 60fF Parasitic capacitance and mismatch of ... finger gap, and the ratio of parasitic capacitance and sensing capacitance Since m, and d are limited by process technology, sensitivity is most effectively increased by adjusting k, and Vm As discussed ... are shown in Figure 2.9 The symmetric topology (Figure 2.9 (a) ) has the advantages of simplicity and less parasitic capacitance along with the disadvantage that a cross-axis acceleration signal...
- 40
- 580
- 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
Ngày tải lên :
18/02/2014, 08:20
... molecular mass was also estimated by SDS–PAGE Characterization and comparative analyses of HYDJs and HYDBp The optimal temperature for activity of HYDJs with d-pHPH as substrate was determined by ... databases have provided an additional source for identifying d-hydantoinases with high catalytic activity In this study, an approach combining genomic database mining and activity screening was ... HYDJs activity, and intriguingly, mutagenesis of Leu92 to Ala and Val, two smaller hydrophobic residues, actually reduced the catalytic activity to less than approximately 50% of that of the...
- 14
- 621
- 0
Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identification of a novel subtype of thyrotropin-releasing hormone receptor ppt
Ngày tải lên :
21/02/2014, 03:20
... amplified as described above using partially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAA CGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TC TGTTAAATGTACCTAAGTAGGCA-3¢) and ... three sets of primers: first set, A5 1 (5¢GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7 (5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8 (5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); third ... third set, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATG Ó FEBS 2002 CAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCA GATAC-3¢) (Fig 1C) The PCR products were analyzed by agarose gel electrophoresis, purified and cloned...
- 11
- 506
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
Ngày tải lên :
07/03/2014, 21:20
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... PP2500 and ANKHD1 variant In this study we focus on the biochemical and functional characterization of the novel VBARP-L and VBARP-S transcripts Bioinformatics analyses show that VBARP-L and VBARP-S ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...
- 12
- 561
- 0
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
Ngày tải lên :
16/03/2014, 05:20
... gold and alkylated gold, and from a quantitative amino acid analysis for glass and the formaldehyde resin (see details in supplementary Fig S3) Surface area per molecule was calculated by a assuming ... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k Bicp19k 130 140 ... Mountain View, CA, USA), and poly (A) + RNA was isolated using Oligo(dT)-Latex Super (Takara Shuzo Co.) cDNA was prepared from mRNA with a Zap-cDNA synthesis kit (Stratagene, La Jolla, CA, USA) according...
- 11
- 488
- 0
Báo cáo khoa học: cDNA cloning and characterization of a novel calmodulinlike protein from pearl oyster Pinctada fucata potx
Ngày tải lên :
16/03/2014, 23:20
... nucleotide sequence of oyster CaLP cDNA obtained by RACE, a PCR reaction was performed using a pair of specific primers P3 (5¢-GGAAGAATACAGACACGGACAG-3¢) and P4 (5¢-ATAACAACAGTTTATACATCGCTTC-3¢) corresponding ... sequence of CaLP2 were used in the nested PCR reactions The first round of PCR reaction was performed with a forward primer UPM (a mixture of primers 5¢-CTAATACGACTCACTATAGGGC AAGCAGTGGTAACAACGCAGAGT-3¢ ... sequence, an open reading frame consisting of 483 bp, a TGA stop, a 146 bp 3¢-untranslated sequence, and a poly (A) tail of 18 nucleotides A putative polyadenylation signals (AATAAA) is recognized at...
- 12
- 375
- 0
Báo cáo khoa học: Structure, epitope mapping, and docking simulation of a gibberellin mimic peptide as a peptidyl mimotope for a hydrophobic ligand pot
Ngày tải lên :
16/03/2014, 23:20
... stage, the same protocol was applied by adding hydrogen bond restraints and dihedral angle restraints Additional NOE constraints were added in each round of calculations, and restraints that ... peptide-antibody recognition 11 Murata T, Fushinobu S, Nakajima M, Asami O, Sassa T, Wakagi T & Yamaguchi I (2002) Crystal structure of the liganded anti-gibberellin A4 antibody 4-B8(8) ⁄ E9 Fab fragment ... 3b-hydroxy and 6b-carboxyl groups of GA4 form hydrogen bonds with Ala33H of the main chain, and with Thr53H of the heavy chain, respectively Furthermore, C ⁄ D rings of GA4 were in van der Waals’ contact...
- 11
- 565
- 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
Ngày tải lên :
17/03/2014, 03:20
... ether cleavage activity was measured as described above Localization of b-aryl ether cleavage activity A 14-day-old culture (4 mL) of 2BW-1 cells was separated into supernatant and residue by centrifugation ... indicated that the b-aryl ether cleavage enzyme accumulated and was stable in the extracellular fraction The extracellular fraction of 2BW-1 generated abundant GG and 4MU from GOU by cleaving ... ether cleavage activity, we prepared a hyphae fraction (HP), an extracellular fraction (EC), a cytoplasmic fraction (CY) and a membrane fraction (M) from cultures of 2BW-1 (see Materials and methods)...
- 10
- 670
- 0
hydrothermal synthesis and crystal structure of a novel one - dimensional tritungstate
Ngày tải lên :
19/03/2014, 16:48
... cmy1 are ascribed to Õ ŽW s O., and the features in the 784–889 cmy1 region are most likely associated with Õ ŽO–W–O modes In addition, absorption bands at 1480 and 1624 cmy1 , and a broad band ... 0.90 A w I ) s Ž I x for 134 parameters and converged to R 1Ž wR s 0.0281Ž0.0634 Atomic coordinates, bond lengths and angles and thermal parameters are presented in supplementary crystallographic ... initially isolated from the hydrothermal reaction of WO , en, NaOH and H O in polycrystalline form Replacement of NaOH with LiOH produces the same crystalline phase with similar product quality and...
- 4
- 379
- 0
Case Study in Financial Modeling and Simulation of a Forestry Investment potx
Ngày tải lên :
23/03/2014, 04:20
... fire, pests and diseases, unsuitable species, collateral damage at harvest Forestry Risks Timber return: inappropriate pruning and thinning, poor growth, timber usage and fashion changes Sovereign ... Wood growth is measured by the MAI: Mean Annual Increment; ‘the annual increase in cubic meters of harvestable timber per hectare’ The MAI is influenced byrelevant rainfall, soil fertility, ... can span a lifetime of over 50 years Cash Flow Structure General for Projects initial cash outlay inflows from sale of product Particular to Forestry long term maintenance timed on-going outlays:thinnings,...
- 18
- 785
- 4
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx
Ngày tải lên :
23/03/2014, 09:21
... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... Primer pairs were: #GSP-4 and #PFLF1 (lanes and 2); #GSP-2 and #GSP-4 (lanes and 4); #GSP-2 and #PFLR-1 (lanes and 6); and #PFLF-1 and #PFLR-1 (lanes and 8) (B) Schematic organization of the CrPrx ... database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A2 (Q42578) and HRP-C (AAA33377) Residue...
- 14
- 347
- 0
Báo cáo khoa học: Identification of a novel thyroid hormone-sulfating cytosolic sulfotransferase, SULT1 ST5, from zebrafish Molecular cloning, expression, characterization and ontogenic study ppt
Ngày tải lên :
23/03/2014, 15:20
... 5¢-TATGTAGGAGCTACAAGAAACATTGAAGGC-3¢ 5¢-CAATTCTTACTAGCTGCAGGGAGGGTTGGT-3¢ 5¢-GAATTGGCCCTAATTTGCACATTAAAGATA-3¢ 5¢-GCCTGAAGTTTTTGGTTCACAGTGAAATTT-3¢ 5¢-ACACTCTGAAGGGGAATTAGGATTAAGAAA-3¢ 5¢-CTGACTATACAAGGCTGTGTGCCACAAAAC-3¢ ... 5¢-CTGACTATACAAGGCTGTGTGCCACAAAAC-3¢ 5¢-GAAAACACATCACGTACCCTCCCTCTCTGCG-3¢ 5¢-ACATCATGGTATATTATTCATTTAGCTGACACTTT-3¢ 5¢-ATGGATGAGGAAATCGCTGCCCTGGTC-3¢ 5¢-TTAGAAGCACTTCCTGTGAACGATGGA-3¢ 3835 A novel ... ATGAGCCGGAGAACAAGCGAAACT-3¢) and antisense (5¢-CGCGGATCCTTATATAGTGAAGCGTATTGGAAG FEBS Journal 272 (2005) 3828–3837 ª 2005 FEBS S Yasuda et al A novel zebrafish cytosolic sulfotransferase AGGACA-3¢)...
- 10
- 336
- 0
Báo cáo Y học: Identification and characterization of a novel activated RhoB binding protein containing a PDZ domain whose expression is specifically modulated in thyroid cells by cAMP pot
Ngày tải lên :
23/03/2014, 21:20
... (1977) Analysis of singleand double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange Proc Natl Acad Sci USA 74, 4835–4838 Savonet, V., Maenhaut, C., ... N., Madaule, P., Reid, T., Ishizaki, T., Watanabe, G., Kakizuka, A. , Saito, Y., Nakao, K., Jockusch, B.M & Narumiya, S (1997) p140mDia, a mammalian homolog of Drosophila diaphanous, is a target ... kinase, PKN, and rhophilin in the rho-binding domain J Biol Chem 271, 13556–13560 15 Ishizaki, T., Maekawa, M., Fujisawa, K., Okawa, K., Iwamatsu, A. , Fujita, A. , Watanabe, N., Saito, Y., Kakizuka,...
- 9
- 394
- 0
Báo cáo khoa học: Physiological truncation and domain organization of a novel uracil-DNA-degrading factor pdf
Ngày tải lên :
29/03/2014, 08:20
... Hydroxylamine cleavage Mapping of electrostatic potential Analysis of C-ter fragment Prediction of DNA binding site DNA binding by EMSA DNA cleavage assay Quaternary structure by gel flitration ... concentration of 1–6 mgÆmL)1 Analytical ultracentrifugation analysis An Optima XL -A analytical ultracentrifuge (BeckmanCoulter, Palo Alto, CA, USA) was used to perform the analytical ultracentrifugation ... GCA AAT GAA CTG GGC GAT GCG GTC GCA CUA CTT CAC CTC GAA ATC AAC ATC TGA GTG-3¢ (with the uracil position underlined) The complementary oligonucleotide was 5¢-CAC TCA GAT GTT GAT TTC GAG GTG AAG...
- 15
- 413
- 0
Báo cáo khoa học: Crystal structure determination and inhibition studies of a novel xylanase and a-amylase inhibitor protein (XAIP) from Scadoxus multiflorus pot
Ngày tải lên :
29/03/2014, 09:20
... observations indicate that XAIP associates with GH11 xylanase and GH13 a- amylase, as well as with both xylanase and a- amylase simultaneously Tissue distribution of XAIP The output of SDS–PAGE for ... corresponding band was absent in the leaf and flower samples, whereas, in the root sample, a very thin band of XAIP was visible The enzyme inhibition assay using GH11 xylanase and GH13 a- amylase showed maximum ... (2003) Kinetics and energetics of the binding between barley alpha-amylase ⁄ subtilisin inhibitor and barley alpha-amylase analyzed by surface plasmon resonance and isothermal titration calorimetry...
- 15
- 399
- 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx
Ngày tải lên :
30/03/2014, 20:20
... nucleoskeleton as well as a peripheral lamina in human cells J Cell Sci 108, 635–644 10 Jagatheesan G, Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear ... and characterization of a novel zinc finger protein that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization ... H2O2 and diaminobenzidine (B) A rat liver nuclear fraction was treated with DNase–RNase and the solubilized fraction (chromatin fraction, B5) was separated by centrifugation The pellet was extracted...
- 12
- 400
- 0
báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc
Ngày tải lên :
19/06/2014, 10:20
... showed that the stress-strain profile of the unadulterated PU foam sample and that of the PPy-coated PU foams sample were similar showing regions of elastic and inelastic responses to force Problems ... resistance and range of the measured resistance of the sensors as determined through a series of standard repeatable exercises by the Page of (page number not for citation purposes) Journal of NeuroEngineering ... organization and supervised the research All authors read and approved the final manuscript Acknowledgements This material is based on works supported by Science Foundation Ireland under Grant...
- 7
- 748
- 0