duty of the holder of a time limited interest to repair replace and renew

Báo cáo y học: "Ablation of atrial fibrillation with the Epicor system: a prospective observational trial to evaluate safety and efficacy and predictors of success" pptx

Báo cáo y học: "Ablation of atrial fibrillation with the Epicor system: a prospective observational trial to evaluate safety and efficacy and predictors of success" pptx

Ngày tải lên : 10/08/2014, 09:22
... heparin and amiodarone With reconvalescence of the patient, anticoagulation (warfarin or coumadin) and antiarrhythmic therapy (amiodarone 200 mg/d) were switched to oral medication and maintained ... for a postoperative pacemaker implantation was low [6] An appropriate postoperative management is important after AF surgery Since the maturation of the transmural lesions and the electrical isolation ... this article as: Schopka et al., Ablation of atrial fibrillation with the Epicor system: a prospective observational trial to evaluate safety and efficacy and predictors of success Journal of Cardiothoracic...
  • 6
  • 480
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20
... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... molecular mass markers be further accumulated within the mitochondria due to the mitochondrial membrane potential [11] From the known plasma and mitochondrial membrane potentials and the cell and ... that mitoDC81 alkylates mtDNA in mitochondria or cells The reasons for the lack of alkylation of mtDNA within mitochondria by mitoDC-81 are unclear The local concentrations of mitoDC-81 and DNA,...
  • 10
  • 638
  • 0
Báo cáo sinh học: " Research Article Applications of a Weighted Symmetrization Inequality to Elastic Membranes and Plates" pptx

Báo cáo sinh học: " Research Article Applications of a Weighted Symmetrization Inequality to Elastic Membranes and Plates" pptx

Ngày tải lên : 21/06/2014, 17:20
... circular plate of variable thickness,” Indian Journal of Pure and Applied Mathematics, vol 11, no 2, pp 258–267, 1980 10 H D Conway, The bending of symmetrically loaded circular plates of variable ... results of the paper References G Reyes and J L V´ zquez, A weighted symmetrization for nonlinear elliptic and parabolic a equations in inhomogeneous media,” Journal of the European Mathematical ... 2 Journal of Inequalities and Applications ∗ where C is a constant depending on a x and h x , whereas Ω∗ and fμ denote μ symmetrizations of Ω and f, with respect to the measure μ, respectively;...
  • 12
  • 177
  • 0
not a suicide pact the constitution in a time of national emergency sep 2006

not a suicide pact the constitution in a time of national emergency sep 2006

Ngày tải lên : 10/06/2014, 23:24
... from a feather quill It also means that they tend to be pragmatic (pragmatism is the American national culture), hence forward-looking rather than slaves to history Anyway, they are lawyers rather ... than historians, and, being lawyers, treat history not as a guide but as a trove of anecdotes and rhetorical flourishes And because they are trained in the common law, which is a body of law made ... sense of what the case is about and what the statute is about before starting to parse the statute Judicial bias in the pejorative sense means taking account of considerations, such as a litigant’s...
  • 186
  • 1K
  • 0
báo cáo sinh học:" Using nurses to identify HAART eligible patients in the Republic of Mozambique: results of a time series analysis" potx

báo cáo sinh học:" Using nurses to identify HAART eligible patients in the Republic of Mozambique: results of a time series analysis" potx

Ngày tải lên : 18/06/2014, 17:20
... design of the data, participated in the data analysis and drafted the original text MAM participated in the data analysis and made significant comments on progressive drafts MAM was supported in part ... such as mandatory cotrimoxazole prophylaxis regimens, and 3) case review and approval by a multidisciplinary committee designed to improve coordination and quality assurance Delays at any of these ... proportional hazards regression was also used to evaluate the bivariate association between the intervention and the promptness of starting HAART, as well as with other variables (study site and study...
  • 9
  • 492
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Ngày tải lên : 07/03/2014, 16:20
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
  • 12
  • 772
  • 0
A Designer''''s Guide to Adobe InDesign and XML: Harness the Power of XML to Automate your Print and Web Workflows pptx

A Designer''''s Guide to Adobe InDesign and XML: Harness the Power of XML to Automate your Print and Web Workflows pptx

Ngày tải lên : 14/03/2014, 23:20
... Where those designations appear in this book, and Peachpit was aware of a trademark claim, the designations appear as requested by the owner of the trademark All other product names and services identified ... browser to draw a circle, the browser draws a circle PCDATA PCDATA stands for Parsed Character Data PCDATA refers to raw text contained within elements and/ or entities that appear between opening and ... identifying and structuring data Basically designed to be a display language, HTML provides no means to handle data-intensive applications So a group of researchers began the development of an alternative...
  • 337
  • 6.1K
  • 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Ngày tải lên : 30/03/2014, 20:20
... human cells J Cell Sci 108, 635–644 10 Jagatheesan G, Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing factors ... 5¢-CATGAACCGGTTTGGTAC-3¢ as the 5¢ primer, and C, 5¢-CTATCCCACGGTGACAA AGC-3¢ as the 3¢ primer The sequence between these primers was amplified by PCR using Ex Taq DNA polymerase (Takara, Tokyo, ... IgG), and developed as in (A) The arrowheads indicate ISP36 The bars at the left of panels indicate the positions of marker proteins of 97, 66, 43 and 29 kDa from top to bottom 4332 FEBS Journal...
  • 12
  • 400
  • 0
báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx

báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx

Ngày tải lên : 21/06/2014, 20:20
... The data structure is dynamic in order to adapt to different types of data The length of packet and data, number and size of flits, and the depth of VC are all parameterized The size of flits can ... packet to several flits (iii) Adaptor pack adds header and Tail flits to the initial data (iv) Fifo NA stores the completed packet (v) Adaptor flit cuts the whole packet into several 8-bit flits Adaptor ... parameterized architecture dedicated to image analysis applications on FPGA All flows and data are analyzed to propose two generic NoC architectures, a ring for results and command and a dedicated...
  • 15
  • 389
  • 0
Báo cáo hóa học: " Research Article Modelling and Comparative Performance Analysis of a Time-Reversed UWB System" doc

Báo cáo hóa học: " Research Article Modelling and Comparative Performance Analysis of a Time-Reversed UWB System" doc

Ngày tải lên : 22/06/2014, 19:20
... various signal degradations and error performance analysis, Section overviews a UWB and TR-UWB simulation, together with a comparative analysis of the theoretical and simulated results for a timereversed ... SIMULATED AND ESTIMATED RESULTS All-RAKE and TR-UWB simulations were adapted from a time hopped PPM UWB simulation by Di Benedetto and Giancola [32] The cardinality and periodicity of each time ... illustrated in Figures 10 and 11 The plots indicate the maximum, minimum, and average BER rates over all users for both All-RAKE and TR-UWB simulations, and also the average performance as based...
  • 11
  • 333
  • 0
Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Ngày tải lên : 23/06/2014, 01:20
... if the kernel is too narrow, suppression of IT also takes away some of the AT energy leading to smearing of the TFD On the other hand, if the kernel shape is too broad, it cannot suppress all the ... constructing TFDs according to the application in hand, that is, to tailor the TFD according to the properties of the signal being analyzed It is appropriate to call such TFDs as adaptive TFDs In the present ... properties The vectors are selected from a family of waveforms called a dictionary The signal x(t) is projected onto a dictionary of TF atoms obtained by scaling, translating, and modulating a window...
  • 8
  • 355
  • 0
Báo cáo khoa học: "Intensity-Modulated Radiotherapy for Squamous Cell Carcinoma of the Anal Canal: Efficacy of a Low Daily Dose to Clinically Negative Regions" ppsx

Báo cáo khoa học: "Intensity-Modulated Radiotherapy for Squamous Cell Carcinoma of the Anal Canal: Efficacy of a Low Daily Dose to Clinically Negative Regions" ppsx

Ngày tải lên : 09/08/2014, 09:21
... superior to radiotherapy alone in the treatment of locally advanced anal cancer: results of a phase III randomized trial of the European Organization for Research and Treatment of Cancer Radiotherapy ... physical examination findings were favorable Statistical Analysis The Kaplan-Meier method was used to calculate and estimate rates of overall survival and freedom from any disease relapse Data were ... Intensity-Modulated Radiotherapy for Squamous Cell Carcinoma of the Anal Canal: Efficacy of a Low Daily Dose to Clinically Negative Regions Jason A Call1, Michael G Haddock1, J Fernando Quevedo2,David W Larson3,...
  • 19
  • 374
  • 0
Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx

Báo cáo y học: "Insights into spatial configuration of a galactosylated epitope required to trigger arthritogenic T-cell receptors specific for the sugar moiety" ppsx

Ngày tải lên : 09/08/2014, 10:21
... concentrations of competitor peptides were added to each assay Data are expressed as the percentage of response in the absence of competitor and are representative of at least two separate experiments ... the manuscript, and also interpretation and discussion of the data 12 13 14 15 16 17 Acknowledgements The authors are indebted to Drs Orly Amar and Alexandra Doncarli for help with the initiation ... T-cell reactivities of hybridomas A2 G10, A9 E5 and A8 E2, and clone A9 .2 to several CII256–270 analogues T cells were stimulated with increasing A2 G10, A9 E5 and A8 E2, and clone A9 .2 to several CII256–270...
  • 9
  • 318
  • 0
Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx

Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx

Ngày tải lên : 10/08/2014, 05:20
... laboratory reporting of at least some CD4 counts and viral loads at the time of the study and the third had an established, clinically-based HIV reporting system that had been in place and integrated ... facilitate entry into adequate care Key advantages include the ability to draw inference to the population of patients in care for HIV infection, and beginning in 2008, the availability of annual ... AIDS case to the health department; some providers of care may have been left off the sampling frame if they had never reported an HIV case However, two of the participating states had laboratory...
  • 7
  • 337
  • 0
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx

Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx

Ngày tải lên : 10/08/2014, 10:20
... multivariate analysis of cancer-related survival in the total populationa Risk factor Multivariate analysisc Univariate analysis p valueb R-status Masaoka stagingd Presence of a pseudocapsula WHOd classificatione ... Okumura M, Ohta M, Tateyama H, Nakagawa K, Matsumura A, Maeda H, Tada H, Eimoto T, Matsuda H, Masaoka A: The World Health Organization histologic classification system reflects the oncologic behavior ... case each in patients with an incomplete encapsulated thymoma or a missing capsula Neo-Adjuvant and Adjuvant Therapy As far as a neoadjuvant or adjuvant therapy is concerned two major aspects...
  • 10
  • 355
  • 0
Báo cáo y học: "Soft-tissue perineurioma of the retroperitoneum in a 63-year-old man, computed tomography and magnetic resonance imaging findings: a case report" doc

Báo cáo y học: "Soft-tissue perineurioma of the retroperitoneum in a 63-year-old man, computed tomography and magnetic resonance imaging findings: a case report" doc

Ngày tải lên : 11/08/2014, 03:21
... 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan 2Department of Pathology Saitama Red Cross Hospital, 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan Authors’ contributions MY conceived the ... YK and RM performed the literature review AA and KK performed histopathologic and immunohistochemical analyses All authors read and approved the final version of the manuscript Competing interests ... of soft-tissue perineuriomas are hypocellular, and 20% are markedly hypercellular The stroma can vary from a more collagenous to a myxoid appearance Figure Structure of the mass (a) Cut surface...
  • 4
  • 384
  • 0
Báo cáo y học: "Conservative management of a grade V injury to an ectopic pelvic kidney following blunt trauma to the lower abdomen: a case report" ppsx

Báo cáo y học: "Conservative management of a grade V injury to an ectopic pelvic kidney following blunt trauma to the lower abdomen: a case report" ppsx

Ngày tải lên : 11/08/2014, 06:23
... and participated in its coordination AMB participated in the drafting of the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have ... kidney, and suggest that management of these high-grade injuries to ectopic kidneys can be treated similarly to that of kidneys in a normal anatomic position Specifically, these injuries can be managed ... is available for review by the Editor-in-Chief of this journal Authors’ contributions ABB participated in the design of the study and the drafting of the manuscript MBB conceived of the study and...
  • 3
  • 304
  • 0
Báo cáo y học: "Soft-tissue perineurioma of the retroperitoneum in a 63-year-old man, computed tomography and magnetic resonance imaging findings: a case report." pps

Báo cáo y học: "Soft-tissue perineurioma of the retroperitoneum in a 63-year-old man, computed tomography and magnetic resonance imaging findings: a case report." pps

Ngày tải lên : 11/08/2014, 07:20
... 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan 2Department of Pathology Saitama Red Cross Hospital, 8-3-33, Kamiochiai, Chuo-ku, Saitama, Saitama, Japan Authors’ contributions MY conceived the ... YK and RM performed the literature review AA and KK performed histopathologic and immunohistochemical analyses All authors read and approved the final version of the manuscript Competing interests ... of soft-tissue perineuriomas are hypocellular, and 20% are markedly hypercellular The stroma can vary from a more collagenous to a myxoid appearance Figure Structure of the mass (a) Cut surface...
  • 4
  • 387
  • 0
Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf

Báo cáo y học: " Relatives Education And Coping Toolkit - REACT. Study protocol of a randomised controlled trial to assess the feasibility and effectiveness of a supported self management package for relatives of people with recent onset psychosis" pdf

Ngày tải lên : 11/08/2014, 15:22
... professional/paraprofessional, and a CBT (Cognitive Behaviour Therapy) rather than educational model [10] Self-management approaches can increase dissemination of evidence based interventions to large ... the relative is in They are given the trial allocation by telephone RA2 contacts the relative by telephone and post to inform them which arm of the trial they have been allocated to RA2 contacts ... Categorisation and thematic analysis of the data will be developed by cycling between the analysis and transcripts and periodic ‘testing’ of the analysis by discussion amongst the entire team...
  • 7
  • 305
  • 0