duranensis and a ipaënsis being the most probable progenitors of the cultivated species
báo cáo khoa học: " Identification of candidate genome regions controlling disease resistance in Arachis" doc
... participated in writing the manuscript, marker development, analysis of data and co-ordination of the study All authors read and approved the final manuscript Additional material The best characterized ... participated in genotyping and did the linkage and QTL analysis APF participated in bioassays RV participated in the marker screening and genotyping work that enabled the linkage of Arachis maps ... linkage map of the A- genome of peanut Linkage Groups A6 to A1 0 A genetic linkage map of the A- genome of peanut Linkage Groups A6 to A1 0 A genetic linkage map, obtained through the analysis of...
- 12
- 350
- 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot
... Materials and Fig Deadenylation of IFN-b mRNA is independent of translation (A) Deadenylation analysis of the PIFNHA and PIFNHA hp transcripts Hec-1B cells were transfected with the PIFNHA and ... autoradiography (C) Polyadenylated IFN-b mRNA AU+ was transcribed from the pBSIFNpA The poly (A) – IFN-b mRNAs, AU+pA– and AU–pA–, were transcribed from the pSP65IFN construct linearized by BamHI and ... mRNA deadenylation and subsequent degradation of the RNA body c-fos, c-myc and plasminogen activator inhibitor (PAI-2) messenger RNAs are other ARE-containing mRNAs bearing instability determinants...
- 8
- 361
- 0
Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx
... pS3aPGDa3), pS3aPGDa6 ,a7 ,t13 (or pS3aPGDa6), pS3aPGDa8 a1 1,t15 (or pS3aPGDt15), pS3aPGDa12,t17 (or pS3aPGDa12), pS3aPGDa13 a1 5 (or pS3aPGDa14), pS3aPGDa16 a1 8 (or pS3aPGDa18), pS3aPGDa1.2, and ... Vertical bars (numbered 1–18) indicate ATTA motifs in the forward strand Vertical bars indicate 25 ATTA motifs in the reverse strand, and the four GNNATTA sites in the reverse strand are labelled ... al A 18 17 16 15 14 13 12 1110 *1 * six 3a promoter region (pS3aP) t17 t15 t2 t13 * a1 0 a9 a8 a6 a4 a5 a3 a1 a2 a7 x 200 B a1 8 a1 7 a1 6 a1 5 a1 4 a1 3 a1 2 a1 1 t17 t15 t13 t2 t6 a2 a1 a1 1 x 200 C a9 ...
- 15
- 349
- 0
Báo cáo sinh học: "Analysis of the human cytomegalovirus genomic region from UL146 through UL147A reveals sequence hypervariability, genotypic stability, and overlapping transcripts" ppt
... contributed to the design of the study, analyzed the data from the Portland site, and helped to draft the manuscript AMF performed the sequencing and transcriptional analysis at the Chicago site HML ... 5'-ATCTCTGCGAGGATGCTAGT-3' or 5'TGGCCAGGCACCGAACTCAA-3' The 3-prime portion of the UL147 ORF plus the entire UL14 7A ORF was sequenced using the forward primer: 5'-AAGCTGCAATCGTCAGGAAG-3' The ... Northern analysis of temporal transcriptional pattern of UL146 through UL132 Northern analysis of temporal transcriptional pattern of UL146 through UL132 Total RNA was extracted at the indicated...
- 18
- 395
- 0
Báo cáo hóa học: " The complete genome sequence of a Crimean-Congo Hemorrhagic Fever virus isolated from an endemic region in Kosovo" pot
... polyprotein of Kosova Hoti B Scheme of the L protein of Kosova Hoti strain DD performed RNA extraction, qualitative and quantitative RT-PCR, analyzed the data and prepared the draft manuscript MK and ... much of Asia, extending from China to the Middle East and Southern Russia and to the focal endemic areas in Africa and southern Europe, including Kosovo and Turkey [2] Yearly epidemics, as well as ... data TAZ isolated the virus, supervised the study and revised the final draft All authors read and approved the final manuscript Page of (page number not for citation purposes) Virology Journal...
- 6
- 318
- 0
Báo cáo y học: " ZINBA integrates local covariates with DNA-seq data to identify broad and narrow regions of enrichment, even within amplified genomic region" doc
... performs favorably relative to existing specialized methods over a broad range of signal patterns and data types ZINBA is implemented as a freely available R package Materials and methods Datasets and ... selected as a standard because of the longstanding use of DNase as a method for identification of open chromatin sites Both ZINBA and MACS called a high proportion of FAIRE sites that overlapped a DHS, ... matures, the ZINBA framework can allow for the continued evaluation of existing covariates and the addition of new covariates to model DNA-seq data Examples of additional potential covariates could...
- 20
- 421
- 0
báo cáo khoa học: " Sequence diversity in three tomato species: SNPs, markers, and molecular evolution" pptx
... more than forty-nine thousand inter and intraspecific polymorphisms mined from the EST databases of the cultivated and two wild species of tomato By taking advantage of the additional information ... sophisticated experimental designs that increase the quality of SNP prediction and information on the SNP's effects For example, by comparing tomato and Arabidopsis thaliana databases a set of markers ... grouped together the data from the interspecific analyses The larger number of sequences available in the intraspecific analysis allowed greater statistical power, although the most over- and underrepresented...
- 11
- 298
- 0
Genetic variability in tomato germplasm (solanum lycopersicum l ) using morphological characteristics and simple sequence repeat (SSR) markers
... (5′-3′) GCGACCCTCTATTGAACTTGAAGAC (F) No of Bases 25 ACAAATCAAAGGAACAATTTCAA (R) 23 GTGGATTCACTTACCGTTACAAGTT (F) 25 CATTCGTGGCATGAGATCAA (R) 20 TTGAAAAGCTGAAAAGTCAATCA(F) 23 GAGAGGTGCCACATCACCTT ... GTCCCTACCCCACAAATTGAA (F) 21 AGGTACAACTCACCTCCCCC (R) 20 GTGAAGACGAAAAACAAGACGA(F) 22 CCTTCCCCTTTTGTCTCTCC (R) 20 GTGAAGACGAAAAACAAGACGA (F) 22 CCTTCCCCTTTTGTCTCTCC (F) 20 TCTTTCAACTTCTCAACTTTGGC ... GCCGACTTCAAAAACTGCTC (R) 20 GCATTGATTGAACTTCATTCTCGTCC (F) 26 ATTTTTGTCCACCAACTAACCG (R) 22 ATTGTAATGGTGATGCTCTTCC (F) 22 CAGTTACTACCAAAAATAGTCAAACAC(R) 27 ATTTCTGTAACTCCTTGTTTC (F) 20 TGACTTCAACCCGACCCCTCTT...
- 113
- 380
- 0
International Capital Flows and Boom-Bust Cycles in the Asia Pacific Region +
... are available for most of the sample period They are Korea, Japan, Indonesia, Thailand, the Philippines, Singapore, Taiwan, Australia, and New Zealand.17 Data sources are International Financial ... countries in the Asia Pacific region: five Asian crisis countries (Indonesia, Korea, Malaysia, the Philippines, and Thailand), China, Singapore, Taiwan, Hong Kong, Japan, Australia and New Zealand Section ... Malaysia Philippines Thailand Japan Indonesia Malaysia Philippines Thailand Japan China Singapore Taiwan Hong Kong Australia New Zealand China Singapore Taiwan Hong Kong Australia 0.66 0.47 0.24 0.70...
- 32
- 579
- 0
Báo cáo y học: "Iraqi health system in kurdistan region: medical professionals’ perspectives on challenges and priorities for improvement"
... SFH and SNP participated in designing the study TR, SFH carried out the data collection SNP, AHTS and ATNG carried out the data analysis SNP and SAM drafted the first version of the paper AHTS and ... including the quality of offered health services, availability of the required quantity and quality of medicines, availability of medical equipments and tools and availability of sufficient number of ... in the health system being the weak role of medical research, the weak role of professional associations, the weak role of health education and the low governmental fund allocation for health...
- 6
- 648
- 0
Báo cáo y học: "Relationships between free radical levels during carotid endarterectomy and markers of arteriosclerotic disease"
... outcome of the PCA of the radical data, data concerning the degree of arteriosclerotic disease and some relevant clinical data are shown in Figure In order to increase the lucidity of the figure the ... constitutes an independent linear combination of variables, capturing a maximum of the variance remaining in the data set, and is orthogonal to all other components In biological material, with a considerable ... with OXANO levels as well as MMP values MCP-1 and oxLDL values are close to origin, indicating a lack of correlation between these values and any of the other variables MMP-9 values appear from...
- 7
- 640
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... 14 Ogawa Y, Itoh H, Nakagawa O, et al Characterization of the 5'-flanking region and chromosomal assignment of the human brain natriuretic peptide gene J Mol Med 1995; 73: 457-63 15 Nakayama T, ... nucleotides and alters the binding sites for the AP2 and zeste transcription factors Transcriptional activity of the deletion allele was less than 30% that of the wild-type allele The deletion allele was...
- 7
- 612
- 1
A study on evidential modal markers in english
... encompasses all forms of secondhand fact such as report, quotation, hearsay, assumption, appearance, and all other types of supportive, auxiliary information, of which quotation and hearsay are ... that in all languages, the clause has the character of a message: it has some form of organization giving it a status of a communicative event In English, as in many other languages, the clause ... their reliability as source of evidence Scale of Scale the Scale finds the ranking of either Scale of Besides, in of grammar of evidentiality, oneof the participants in reliability of Scale of...
- 74
- 977
- 2
Food, Animal production and Human Comsumption in the Asian Region
... casestudy • Cambodia • Lao PDR • Thailand • Vietnam 33 Land and population Population Density Population Land area Cambodia 15,416,429 181,035 85 Lao PDR 6,834,345 236.800 29 Thailand 63,723,953 ... Sheep) Large ruminants ( Cattle, Buffalo) A: Economic: Serve as a current bank account, sale for small B: Social: Fighting, fancy animals cash for daily needs A: Economic: Serve as semi annual account, ... bran, broken rice Crop stems, crop wastes Weeds, marginal land Rice straw, corn stalk Other crop wastes trees, marginal land Poultry (Chicken, Duck & Turkey) Pig and small ruminant (Pigs, Goat...
- 51
- 453
- 0
some renewable energy sources in the ASEAN region
... “Communityled Management of River Environments”, 26 and 27 August at Himalaya Hotel, Kathmandu, Nepal Appan, Adhityan, 2009.”Solar Energy – Current areas of usage and its future potential”, CAFEO 27 ... when power transmissions are installed as underground cables, digging and blasting of ditches affect the hydrology and vegetation of the area (vii) Recreation Areas: Damming of large areas reduces ... identified as most suitable for the harnessing of wind energy, another renewable energy source (Cunanan, 2002) Asean countries lie mainly in the Southeast Asian region and span the equator Since they are...
- 9
- 378
- 0
Sự hòa hợp giữa các thì (Sequence of tenses)
... quite a lot I (join) a club 30 p.m tomorrow the day after I (arrive) Alice and I (wait) at the Activity 2: Complete each of the following sentences with an adverbial clause of time (p 139) had ... was/ b has finished f have taken j had been/ had stopped/ asked/ had c get g shall give/ gets k have worked apologized/ told/ had d speak h come/ will find was waking/ realized/ had seen mistaken ... was ready g came home/ came back/ called you? was leaving home/ the house h I phone her/ she heard knock at the door/ I was went to Italy/ died/ won the Nobel Prize having dinner graduate...
- 3
- 6,779
- 244
KHAI THÁC D. LI.U ESTs (EXPRESSED SEQUENCE TAGs) . CHI CAM CHANH (CITRUS) CHO VI.C PHÁT TRI.N MARKER PHÂN T. SSR (SIMPLE SEQUENCE REPEATS)
... TTGTTACAGTAGCAATTTTGACTCACTCTTAAGTCTTTGCTGTTGTATTGATATCAACTG TTATTGACGACTTTTAATAGTGCATTTCCATGATTTTGTCTATTAACTTGTCAATAAAAGTAAAGA ATTCCTGTATTGCAAAATTACTTT[TATATATATATA]GAGGGGTTATGCGGTCTGGGATCCCAGA CTGTAATTAAAGTCCAGGATTGGGACCATGTGTAGCAGATTAATAAATAAATAAATAAATCCAACG ... TTGTTACAGTAGCAATTTTGACTCACTCTTAAGTCTTTGCTGTTGTATTG ATATCAACTGTTATTGACGACTTTTAATAGTGCATTTCCATGATTTTGTC TATTAACTTGTCAATAAAAGTAAAGAATTCCTGTATTGCAAAATTACTTT [TATATATATATA]GAGGGGTTATGCGGTCTGGGATCCCAGACTGTAATT ... TAAAAGTAAAGAATTCCTGTATTGCAAAATTACTTT[TATATATATATA]GAGGGGTTA TGCGGTCTGGGATCCCAGACTGTAATTAAAGTCCAGGATTGGGACCATGTGTAGCAGA TTAATAAATAAATAAATAAATCCAACGGCCTCAGTCCGGATACTAGTTTGGAT Hình 3.5 nội dung tập tin “labdbout20030101.txt”...
- 71
- 249
- 0
Sequence và Index
... P_END_DATE BUDGET_AMOUNT MAX_NO_STAFF WRITE C030 COURSE 02-JAN-88 07-JAN-88 500 PROOF READ NOTES 01-JAN-89 10-JAN-89 600 Thêm liệu vào bảng ASSIGNMENTS PROJID EMPNO A_ START_DATE A_ END_DATE BILL_RATE ... thuộc schema thời, phải tên schema schema.sequence.CURRVAL schema.sequence.NEXTVAL Để truy cập sequence từ xa, phải datalink schema.sequence.CURRVAL@dblink schema.sequence.NEXTVAL@dblink Trang 68 ... UPDATE DEPT SET DNAME = ‘MARKETING’; ROLLBACK TO INSERT_DONE ; UPDATE DEPT SET DNAME WHERE DNAME =’SALES’; = ‘MARKETING’ COMMIT; 8.3.BÀI TẬP Thêm liệu vào bảng PROJECTS PROJID P_DESC P_START_DATE...
- 3
- 176
- 0
SEQUENCE VÀ INDEX
... EMPNO ENAME JOB 7698 7654 7499 7844 7900 7521 MGR HIREDATE BLAKE MANAGER 7839 01-05-1981 MARTIN SALESMAN 7698 28-09-1981 ALLEN SALESMAN 7698 20-02-1981 TURNER SALESMAN 7698 08-09-1981 JAMES CLERK ... G a trị DEFAULT cột câu lệnh CREATE TABLE hay ALTER TABLE Trong điều kiện ràng buộc CHECK 9.1.2 Thay đổi huỷ sequence Thay đổi sequence: ALTER SEQUENCE sequence_name INCREMENT BY integer START ... Quyển sách upload tại: hutonline.net Oracle - SQL PL/SQL Sử dụng sequence CURRVAL NEXTVAL sử dụng trường hợp sau: Trong danh sách l a chọn câu lệnh SELECT Trong mệnh đề VALUES câu lệnh INSERT...
- 3
- 1,542
- 12
Sequence và index
- 3
- 234
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008