dswi snf complex is accumulated at the coding region of the hsp70 gene after transcription activation
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
Ngày tải lên :
18/02/2014, 06:20
... SGA1_R ATH1_suc2 ATH1_pep4 ATH1_pLC1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT ... CAAATCTATGATTTCTTAAGGGCCA AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG ... GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC...
- 15
- 475
- 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
Ngày tải lên :
20/02/2014, 01:20
... Identification of the genes encoding the four subunits of PDH2 clearly demonstrates that PDH2 is similar to the T profundus dye-l-proDH complex In the present study, the genes encoding the PDH1 ... those of the native enzyme Expression of the PDH1 gene and purification of the recombinant enzyme Characteristics of the recombinant PDH1 We initially attempted to express the PDH1 gene using the ... (data not shown) This suggests that the b1 subunit of PDH1 has the same function as that described for the b subunit of T profundus dye-l-proDH; that is, it catalyzes the first reaction of the...
- 11
- 549
- 0
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf
Ngày tải lên :
23/03/2014, 15:21
... with LAT, but whether these proteins directly or indirectly associate with LAT is still controversial The result of the formation of LAT-mediated complexes is the activation of signaling pathways ... The purpose of this review is to show the benefits of a comprehensive examination of the formation of signaling complexes by multiple techniques Our example is the characterization of the hematopoietic-specific ... [31,32] In confirmation of the role of these LAT tyrosines on Ca2+ influx and the activation of MAP kinases, either mutation of LAT tyrosine 132 or LAT tyrosines 171, 5429 Investigation of multiprotein...
- 10
- 457
- 0
Báo cáo khoa học: Abortive translation caused by peptidyl-tRNA drop-off at NGG codons in the early coding region of mRNA potx
Ngày tải lên :
30/03/2014, 20:20
... the influence of increased concentration of cognate tRNAs The question remains whether the plasmid associated tRNA genes are expressed in the analysed bacteria For this reason, the levels of gene ... even in the presence of IPTG induction All of these results suggest that the low gene expression associated with NGG codons in the downstream region following the initiation codon [9,10], is the ... translation initiation as long as the first ribosome is still translating any codon in the early region downstream of the initiation codon If the NGG codons in the downstream region are translated...
- 11
- 510
- 0
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
Ngày tải lên :
18/06/2014, 16:20
... with one pathogenic mutation in the GJB2 gene may have another as yet unidentified pathogenic mutation in the promoter region or other noncoding regions of GJB2 To evaluate the impact of the IVS1+1G>A ... mutation in only one allele of the coding region of the GJB2 gene [41] It is also lower than the value of 4.6% among Brazilian patients with one pathogenic GJB2 mutation [42] The percentage of the ... carry only one pathogenic mutation in the GJB2 gene with either recessive or unclear pathogenicity, despite direct sequencing of the entire coding region of the gene [12-14] The ratio of a 309-kb...
- 7
- 695
- 0
Báo cáo y học: "Deciphering the molecular machinery of stem cells: a look at the neoblast gene expression profile" pps
Ngày tải lên :
14/08/2014, 20:22
... representation of the distribution (percentage) of genes by Graphical representation of the distribution (percentage) of genes by functional category (a) The Dj600 chip, (b) genes that are downregulated ... fied a set of genes that were selectively upregulated after lowdose X-ray treatment On the basis of data presented in the literature we hypothesize that most of them act in a coordinated manner, ... mechanisms To select these genes, it is necessary to eliminate the genes that deposited research Supervised analysis II: identification of stem cell protection mechanism related genes The class...
- 17
- 310
- 0
Estrogen receptor a mediated long rang chromatin interactions at the ret gene locus in breast cancer
Ngày tải lên :
05/10/2015, 21:29
... The reduction in RET expression after E2 treatment was also observed at the protein level This abolishment of RET up-regulation after E2 treatment suggested that the E2 up-regulation of RET is ... triplicates 36 3.1.3 The RET gene is a primary target of ERα In order to confirm that RET gene is one of the primary/direct target genes of ERα, MCF7 cells were pre-treated with the protein synthesis ... objectives of the study Comparing the microassay results of the E2 regulation genes with the ChIP-Seq database, we detect a serial of ERBSs around the possible E2 regulated genes From the ChIA-PET data,...
- 90
- 412
- 0
Tài liệu Báo cáo khoa học: A genetic screen identifies mutations in the yeastWAR1 gene, linking transcription factor phosphorylation to weak-acid stress adaptation docx
Ngày tải lên :
19/02/2014, 00:20
... together, our genetic screen identified two mutations in the putative MHR region of the War1p transcriptional regulator, suggesting that the MHR is essential for War1p function Mutations in the ... adenines in the genomic DNA Chromosomal DNA was isolated, and the methylation status was determined by primer extension analysis (Fig 5B) Comparison of the methylation patterns of the different ... hypersensitive to sorbate, and displayed the same growth behavior as the pdr12D control strain These data suggest that the mutants isolated in the UV mutagenesis screen were allelic to WAR1 Thus, the mutant...
- 14
- 627
- 0
How group work is used in speaking lesson of the first year major students of english at viet nam university of commerce
Ngày tải lên :
07/11/2012, 14:50
... English rather than to force them to The first step to this is to raise student’s awareness of the importance of English use for their own learning They should be advised that they are the ones ... lesson 3.6 Data analysis The data of the study was analysed both quantitatively and qualitatively As for quantitative analysis, we used descriptive statistics to quantify the data in form of charts ... listen to my friends (Q) Concerning the factors that caused the difficulties, 85% of the students supposed that they were because of their low English proficiency The subject added that when they...
- 42
- 1.9K
- 4
Tài liệu The life is at the end of the road doc
Ngày tải lên :
25/01/2014, 09:20
... The life is at the end of the road 2010 so sánh số với nước láng giềng Campuchia có 6%, Lào có 13% Thái Lan 9% Theo GS TS Lê Đình Quang, viện nghên cứu ... hứng gió rôto [m2] ρV3 [W/m2] Công suất trục rôto tính theo công thức: P = Think green and action green Page 2 The life is at the end of the road 2010 Một số lưu ý lắp đặt tua bin gió Nói ... thiết kế cho nhà rẻ b ó máy phát điện NLG tùy theo nhu cầu s dụng y n G sử Thin nk green an nd action gr reen Pa age 4 The life is at the end of the road 2010 Các bước để thiết kế hệ thống...
- 8
- 495
- 0
Tài liệu Báo cáo khoa học: It is all about resolution Meeting report based upon presentations at the 10th International Global BioMillennium 2006 symposium on molecular cell biology (Tbilisi, Georgia) docx
Ngày tải lên :
19/02/2014, 02:20
... reduces nonsense-mediated mRNA sensitivity to a region close to the 3¢-end of the mRNA As a next step in the study of the regulation of gene expression, Ada Yonath (Rehovot, Israel) linked ribosomal ... and the nucleus A region in the C-terminus of STAT2 controls its specific export in the absence of interferon STAT1 also shuttles in the absence of interferon, but the exchange rate in unstimulated ... subsequent degradation of the tagged protein, which involves the downstream 26S proteasome complex and unknown mechanisms The common thread in all of these topics is far greater complexity than...
- 4
- 510
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
Ngày tải lên :
20/02/2014, 23:20
... 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were found to be 5–10 °C below that of wild-type ... the PDH assay The interaction of E1 (a2b2) with the PSBD was unaffected by any of the mutations in E1a (Fig 4) Therefore, any effects of the mutations on the catalytic activities of the PDH complex ... nucleophilic attack of ThDP at Ó FEBS 2003 868 M Fries et al (Eur J Biochem 270) the 2-oxo group of the substrate [for a detailed formulation of the mechanism to date, see [44]) The importance of this region...
- 10
- 459
- 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
Ngày tải lên :
21/02/2014, 00:20
... possesses the same characteristics of the interior of the protein matrix The script a is the peak–peak distance between the maximum at %287 nm and the minimum at %283 nm, and the script b is the peak–peak ... maximum at %323 nm at 20 °C The normalization at 400 nm [66] of the two spectra of PsbQ, seen at 295 and 280 nm, shows that the fluorescence emission caused by tyrosine is weak This suggests that there ... values of the ratio a/b, and is the theoretical numerical value of ratio a/b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein under study, dissolved...
- 12
- 550
- 0
Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc
Ngày tải lên :
21/02/2014, 09:20
... Fermat) • There is a mathematical theory of the propagation of heat • There is a mathematical theory of electromagnetic waves • All of classical field theory from physics is formulated in terms of ... nevertheless the case that proof is the lingua franca of mathematics It is the web that holds the enterprise together It is what makes the subject travel well, and guarantees that mathematical ... project The focus of the present book is on the concept of mathematical proof Although it is safe to say that most mathematical scientists not1 spend the bulk of their time proving theorems, it is...
- 334
- 515
- 0
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
Ngày tải lên :
21/02/2014, 15:20
... characteristics when overexpressed in human 293-cells The main objective of the present work was to find an explanation for this phenomenon It is demonstrated that the formation of the active complex is ... is profoundly influenced by a single amino acid difference, i.e G252R, in a region within the catalytic domain This is the first evidence that this region is involved in the formation of the active ... G252R, is critical for formation of the TPP II complex Ó FEBS 2002 Formation of the tripeptidyl-peptidase II complex (Eur J Biochem 269) 1443 This amino acid is located in the insert within the catalytic...
- 6
- 520
- 0
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt
Ngày tải lên :
16/03/2014, 13:20
... created at the N-terminus of human MPP3 by annealing the following primers: 5¢-GACT ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG ... and at the OPL In mouse retina, Mpp3 was detected at the SAR of the OLM, and at the OPL and IPL Here, we showed that MPP3 forms protein complexes and colocalizes with MPP5 at the SAR of the OLM ... explained by the possible existence of a protein that mediates this interaction in 293 HEK cells by opening up the structure of the molecules and allowing their intermolecular binding This mediator might...
- 14
- 449
- 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot
Ngày tải lên :
17/03/2014, 10:20
... absence of transcriptional repression of the IFN-b promoter Altogether, these results indicate that viral infection triggers the synthesis of a polyadenylated IFN-b mRNA that is deadenylated rapidly ... correlates with the fact that IFN-b mRNA destabilization at later times of infection occurs even when mRNA translation is abrogated by the insertion of a stop codon immediately after the initiation ... abrogated the increase of mRNA accumulation due to the cycloheximide (Fig 1E) This latter observation indicates that increased accumulation of IFN-b mRNA in cycloheximide-treated cells is due to the...
- 8
- 361
- 0
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
Ngày tải lên :
23/03/2014, 04:20
... to the repression of E2F target genes [3,5,9] The binding of LINC with E2F4 ⁄ p130 is disrupted in the S phase At this time, B-MYB, a member of the vertebrate MYB family, is incorporated into the ... together, these data establish LIN54 as an essential member of the LINC ⁄ DREAM complex delayed entry into mitosis [9] To address whether this is an isolated function of LIN9 or whether it is ... provide the basis for a further investigation of the regulation of the cdc2 promoter by LINC in different phases of the cell cycle Discussion The primary goal of this study was to investigate LIN54,...
- 14
- 456
- 0
Báo cáo khoa học: Complex alternative splicing of the hKLK3 gene coding for the tumor marker PSA (prostate-specific-antigen) ppt
Ngày tải lên :
23/03/2014, 20:22
... sites suggests that there is a post-transcriptional regulation of hKLK3 gene expression This is supported by data indicating that the 3.1 kb transcript is more unstable than the major hKLK3 mRNA ... denaturation at 94 °C for min; cycles of denaturation at 94 °C for 30 s, annealing and elongation at 72 °C for 3.30 min; cycles of denaturation at 94 °C for 30 s, annealing and elongation at 70 ... of the transcription initiation site of the hKLK3 gene and the Marathon adaptor primer (AP1) using the Expand Long Template PCR System (Roche Diagnostics) The thermocycling protocol was: denaturation...
- 9
- 349
- 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc
Ngày tải lên :
31/03/2014, 01:20
... from the top of the native gel to the position of the monomeric form of the enzyme From these data, it was concluded that the mutation e19A altered the relationship between subunit e and the other ... aliquot of the medium to perchloric acid The ATP/O ratio stoichiometries were determined from the yield of ATP synthesis rate vs state respiratory rate [30] The ATPase activity was measured at pH ... and eG19L ATP synthases We next sought whether the mutations in the dimerization motif of subunit e affected the dimerization/oligomerization of the ATP synthases Therefore, the presence of Table...
- 10
- 550
- 0