dswi snf complex is accumulated at the coding region of the ftz f1 gene after transcription activation
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... SGA1_R ATH1_suc2 ATH1_pep4 ATH1_pLC1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT ... CAAATCTATGATTTCTTAAGGGCCA AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG ... GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC...
- 15
- 475
- 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
... Identification of the genes encoding the four subunits of PDH2 clearly demonstrates that PDH2 is similar to the T profundus dye-l-proDH complex In the present study, the genes encoding the PDH1 ... those of the native enzyme Expression of the PDH1 gene and purification of the recombinant enzyme Characteristics of the recombinant PDH1 We initially attempted to express the PDH1 gene using the ... (data not shown) This suggests that the b1 subunit of PDH1 has the same function as that described for the b subunit of T profundus dye-l-proDH; that is, it catalyzes the first reaction of the...
- 11
- 549
- 0
Báo cáo khoa học: Abortive translation caused by peptidyl-tRNA drop-off at NGG codons in the early coding region of mRNA potx
... the influence of increased concentration of cognate tRNAs The question remains whether the plasmid associated tRNA genes are expressed in the analysed bacteria For this reason, the levels of gene ... even in the presence of IPTG induction All of these results suggest that the low gene expression associated with NGG codons in the downstream region following the initiation codon [9,10], is the ... translation initiation as long as the first ribosome is still translating any codon in the early region downstream of the initiation codon If the NGG codons in the downstream region are translated...
- 11
- 510
- 0
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
... with one pathogenic mutation in the GJB2 gene may have another as yet unidentified pathogenic mutation in the promoter region or other noncoding regions of GJB2 To evaluate the impact of the IVS1+1G>A ... mutation in only one allele of the coding region of the GJB2 gene [41] It is also lower than the value of 4.6% among Brazilian patients with one pathogenic GJB2 mutation [42] The percentage of the ... carry only one pathogenic mutation in the GJB2 gene with either recessive or unclear pathogenicity, despite direct sequencing of the entire coding region of the gene [12-14] The ratio of a 309-kb...
- 7
- 695
- 0
Báo cáo Y học: A functionally conserved member of the FTZ-F1 nuclear receptor family from Schistosoma mansoni doc
... that the schistosome receptor is not a true orthologue of DHR39 The overall gene structure of Smftz -f1 is complex, with 10 exons, and the presence of four noncoding exons in the 5¢ region of the ... that give rise to distinct protein isoforms is a feature of the FTZ- F1 family in all species so far investigated It is thus surprising that no such variants were detectable for the Smftz -f1 gene ... unlike the other members of the FTZ- F1 receptor family, the Smftz -f1 gene does not give rise to major splicing isoforms encoding different proteins The significance of the two variants that differ...
- 12
- 541
- 0
Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf
... 3’end indicates a general use in all compared organisms We have also analyzed the presence of putative elements in the 5’ region of the gene There is a canonical TATA box at –35 bp from the transcription ... to GUS histochemical assays, the 5’upstream region of the pine gene was able to drive gene expression in pine cotyledons To further characterize the function of the 5’upstream region of the pine ... the 5 region of GS1a to the GUS reporter gene The 981 bp sequence upstream of the translation codon was isolated from the clone by Hae III digestion The resulting fragment was subcloned into the...
- 6
- 327
- 0
How group work is used in speaking lesson of the first year major students of english at viet nam university of commerce
... English rather than to force them to The first step to this is to raise student’s awareness of the importance of English use for their own learning They should be advised that they are the ones ... lesson 3.6 Data analysis The data of the study was analysed both quantitatively and qualitatively As for quantitative analysis, we used descriptive statistics to quantify the data in form of charts ... listen to my friends (Q) Concerning the factors that caused the difficulties, 85% of the students supposed that they were because of their low English proficiency The subject added that when they...
- 42
- 1,861
- 4
Tài liệu The life is at the end of the road doc
... The life is at the end of the road 2010 so sánh số với nước láng giềng Campuchia có 6%, Lào có 13% Thái Lan 9% Theo GS TS Lê Đình Quang, viện nghên cứu ... hứng gió rôto [m2] ρV3 [W/m2] Công suất trục rôto tính theo công thức: P = Think green and action green Page 2 The life is at the end of the road 2010 Một số lưu ý lắp đặt tua bin gió Nói ... thiết kế cho nhà rẻ b ó máy phát điện NLG tùy theo nhu cầu s dụng y n G sử Thin nk green an nd action gr reen Pa age 4 The life is at the end of the road 2010 Các bước để thiết kế hệ thống...
- 8
- 495
- 0
Tài liệu Báo cáo khoa học: It is all about resolution Meeting report based upon presentations at the 10th International Global BioMillennium 2006 symposium on molecular cell biology (Tbilisi, Georgia) docx
... reduces nonsense-mediated mRNA sensitivity to a region close to the 3¢-end of the mRNA As a next step in the study of the regulation of gene expression, Ada Yonath (Rehovot, Israel) linked ribosomal ... and the nucleus A region in the C-terminus of STAT2 controls its specific export in the absence of interferon STAT1 also shuttles in the absence of interferon, but the exchange rate in unstimulated ... subsequent degradation of the tagged protein, which involves the downstream 26S proteasome complex and unknown mechanisms The common thread in all of these topics is far greater complexity than...
- 4
- 510
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were found to be 5–10 °C below that of wild-type ... the PDH assay The interaction of E1 (a2b2) with the PSBD was unaffected by any of the mutations in E1a (Fig 4) Therefore, any effects of the mutations on the catalytic activities of the PDH complex ... nucleophilic attack of ThDP at Ó FEBS 2003 868 M Fries et al (Eur J Biochem 270) the 2-oxo group of the substrate [for a detailed formulation of the mechanism to date, see [44]) The importance of this region...
- 10
- 459
- 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... possesses the same characteristics of the interior of the protein matrix The script a is the peak–peak distance between the maximum at %287 nm and the minimum at %283 nm, and the script b is the peak–peak ... maximum at %323 nm at 20 °C The normalization at 400 nm [66] of the two spectra of PsbQ, seen at 295 and 280 nm, shows that the fluorescence emission caused by tyrosine is weak This suggests that there ... values of the ratio a/b, and is the theoretical numerical value of ratio a/b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein under study, dissolved...
- 12
- 550
- 0
Tài liệu The Proof is in the Pudding - A Look at the Changing Nature of Mathematical Proof doc
... Fermat) • There is a mathematical theory of the propagation of heat • There is a mathematical theory of electromagnetic waves • All of classical field theory from physics is formulated in terms of ... nevertheless the case that proof is the lingua franca of mathematics It is the web that holds the enterprise together It is what makes the subject travel well, and guarantees that mathematical ... project The focus of the present book is on the concept of mathematical proof Although it is safe to say that most mathematical scientists not1 spend the bulk of their time proving theorems, it is...
- 334
- 515
- 0
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
... characteristics when overexpressed in human 293-cells The main objective of the present work was to find an explanation for this phenomenon It is demonstrated that the formation of the active complex is ... is profoundly influenced by a single amino acid difference, i.e G252R, in a region within the catalytic domain This is the first evidence that this region is involved in the formation of the active ... G252R, is critical for formation of the TPP II complex Ó FEBS 2002 Formation of the tripeptidyl-peptidase II complex (Eur J Biochem 269) 1443 This amino acid is located in the insert within the catalytic...
- 6
- 520
- 0
Báo cáo khoa học: MPP3 is recruited to the MPP5 protein scaffold at the retinal outer limiting membrane ppt
... created at the N-terminus of human MPP3 by annealing the following primers: 5¢-GACT ACAAAGACCATGACGGTGATTATAAAGATCATGAC ATCGATTACAAGGATGACGATGACAAGCTCATG-3¢ (sense), and 5¢- GTACAGCTTGTCATCGTCATCCTTG ... and at the OPL In mouse retina, Mpp3 was detected at the SAR of the OLM, and at the OPL and IPL Here, we showed that MPP3 forms protein complexes and colocalizes with MPP5 at the SAR of the OLM ... explained by the possible existence of a protein that mediates this interaction in 293 HEK cells by opening up the structure of the molecules and allowing their intermolecular binding This mediator might...
- 14
- 449
- 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot
... absence of transcriptional repression of the IFN-b promoter Altogether, these results indicate that viral infection triggers the synthesis of a polyadenylated IFN-b mRNA that is deadenylated rapidly ... correlates with the fact that IFN-b mRNA destabilization at later times of infection occurs even when mRNA translation is abrogated by the insertion of a stop codon immediately after the initiation ... abrogated the increase of mRNA accumulation due to the cycloheximide (Fig 1E) This latter observation indicates that increased accumulation of IFN-b mRNA in cycloheximide-treated cells is due to the...
- 8
- 361
- 0
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... to the repression of E2F target genes [3,5,9] The binding of LINC with E2F4 ⁄ p130 is disrupted in the S phase At this time, B-MYB, a member of the vertebrate MYB family, is incorporated into the ... together, these data establish LIN54 as an essential member of the LINC ⁄ DREAM complex delayed entry into mitosis [9] To address whether this is an isolated function of LIN9 or whether it is ... provide the basis for a further investigation of the regulation of the cdc2 promoter by LINC in different phases of the cell cycle Discussion The primary goal of this study was to investigate LIN54,...
- 14
- 456
- 0
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf
... with LAT, but whether these proteins directly or indirectly associate with LAT is still controversial The result of the formation of LAT-mediated complexes is the activation of signaling pathways ... The purpose of this review is to show the benefits of a comprehensive examination of the formation of signaling complexes by multiple techniques Our example is the characterization of the hematopoietic-specific ... [31,32] In confirmation of the role of these LAT tyrosines on Ca2+ influx and the activation of MAP kinases, either mutation of LAT tyrosine 132 or LAT tyrosines 171, 5429 Investigation of multiprotein...
- 10
- 457
- 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc
... from the top of the native gel to the position of the monomeric form of the enzyme From these data, it was concluded that the mutation e19A altered the relationship between subunit e and the other ... aliquot of the medium to perchloric acid The ATP/O ratio stoichiometries were determined from the yield of ATP synthesis rate vs state respiratory rate [30] The ATPase activity was measured at pH ... and eG19L ATP synthases We next sought whether the mutations in the dimerization motif of subunit e affected the dimerization/oligomerization of the ATP synthases Therefore, the presence of Table...
- 10
- 550
- 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... are able to catalyze transglycosylation [3] as depicted in the schematics of the reaction mechanism (Fig 3) Under the present assay Fig Schematics of the double displacement mechanism of retaining ... cleavage [64] The Trp84Leu thus enhanced the transglycosylation/hydrolysis ratio of that enzyme This explanation may also apply to the AMY1 mutant, although the shape of the binding cleft of S buligera ... relationship to the substrate binding site of the enzyme J Biol Chem 245, 454465 32 Hiromi, K (1970) Interpretation of dependency of rate parameters on the degree of polymerization of substrate...
- 14
- 557
- 0
She is going to go on business at the end of June potx
... dụ: at the end of the street (cuối đường), at the end of the book (cuối sách) Mạo từ the đứng trước từ bắt đầu nguyên âm “a, e, i, o, u”, the phát âm /ði/ - Trái nghĩa với at the end” at the ... – bắt đầu Ví dụ at the beginning of May” – vào đầu tháng Năm - Cần ý phân biệt "at the end of " "In the end" để tránh nhầm lẫn “in the end” = “finally” – cuối cùng, sau “in the end” dùng muốn ... thêm chi tiết từ đó) She is going to go on business at the end of June 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: She is going to go on business at the end of June 3 Tại câu lại dịch...
- 5
- 631
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose