draw a basic block diagram of dcs
Tài liệu USA INC. A BASIC SUMMARY OF AMERICA''''S FINANCIAL STATEMENTS pdf
Ngày tải lên :
17/02/2014, 21:20
... (such as
Social Security and Medicare), data per Treasury Dept.'s “2010 Annual Report on the U.S. Government”; 3) Gordon Adams and Matthew
Leatherman, A Leaner and Meaner National Defense,” ...
debate about our nation’s financial situation and outlook. In it, we examine USA Inc.’s income
statement and balance sheet. We aim to interpret the underlying data and facts and illustrate
patterns ... corporate and official government accounting methods, see Laurence J. Kotlikoff, Alan J. Auerbach, and Jagadeesh
Gokhale, “Generational Accounting: A Meaningful Way to Assess Generational Policy,” published...
- 266
- 1.8K
- 0
Tài liệu THE BUFFETT RULE: A BASIC PRINCIPLE OF TAX FAIRNESS docx
Ngày tải lên :
20/02/2014, 19:20
... Some of the wealthiest Americans can hire lawyers and accountants to take
advantage of tax expenditures and loopholes that enable them to pay a lower share of their income in
taxes than average ... High-Income Americans Are Paying Less As a Share of Their
Income Than Middle Class Americans
Because some of the richest Americans pay taxes at such extraordinarily low rates, they end up paying ... well-off can take advantage of tax expenditures and preferential rates on certain income. In a time
when all Americans are being asked to come together to make the sort of shared sacrifices that...
- 8
- 384
- 0
A Knowledgeable Model: Network of C-Objects
Ngày tải lên :
18/09/2012, 10:13
... O. Put
A
0
= A, A
1
= t
1
(A
0
), . . .,
A
m
= t
m
(A
m-1
), and D (A) = A
m
,
we have A
0
⊆ A
1
⊆ . . . ⊆ A
m
= D (A) ⊆ M.
A problem A → B on a network (O,F) is called solvable if and only ... B
i-1
.
4 Application Example
Now we state an application example: solve a geometry problem. This example is solved by a
program written in the programming language C++. The program gave us a good ... the above figure 2, suppose that AB = AC, the values of the angle A and the edge BC are given.
ABDE and ACFG are squares. Compute EG.
The problem can be considered on the network of C-objects as...
- 8
- 365
- 2
Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"
Ngày tải lên :
25/10/2012, 09:56
... Kongstad P, Kurola J, Nakstad AR, Sandberg M: Pre-
hospital airway management: guidelines from a task force from the
Scandinavian Society for Anaesthesiology and Intensive Care Medicine.
Acta Anaesthesiol ... have come to our attention. Targets of
action and problems that may need to be resolved are
listed below.
ã A national, standardized medical operative ambu-
lance manual is needed
ã A national, ... WF, Baskett PJ: Recommendations for uniform reporting of data
following major trauma–the Utstein style. A report of a working party of
the International Trauma Anaesthesia and Critical Care Society...
- 11
- 705
- 1
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
Ngày tải lên :
25/10/2012, 10:02
... (MedCalc Software, Mariakerke, Bel-
gium). statistical software was used for all statistical anal-
yses. Categorical data are presented as absolute and
relative frequencies, continuous variables as ... Diabet Med 2006,
23:1370-1376.
34. Ishihara M, Inoue I, Kawagoe T, Shimatani Y, Kurisu S, Hata T, Nakama Y,
Kijima Y, Kagawa E: Is admission hyperglycaemia in non-diabetic
patients with acute ... Ako J, Kadowaki T, Funayama H, Sugawara Y, Kubo N,
Momomura S: Impact of acute hyperglycemia during primary stent
implantation in patients with ST-elevation myocardial infarction. J
Cardiol...
- 8
- 656
- 1
Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"
Ngày tải lên :
25/10/2012, 10:06
... James F Gardner
1
, Gerd Glaeske
5
and
Satish C Valluri
1
Address:
1
Pharmaceutical Health Services Research, School of Pharmacy, University of Maryland, Baltimore, Maryland, USA,
2
Department ... provided data and participated in
the design and analysis of the study. JFG and SCV pro-
vided computerized data management and statistical
analysis. JMZ and DJS drafted the manuscript. JMF and
LTWJ ... methylphenidate and amphetamine
products. Anticonvulsant-mood stabilizers (ATC-MS)
included carbamazepine, divalproex/valproic acid, lamo-
trigine, gabapentin and topiramate. Cross-national com-
parisons...
- 8
- 488
- 1
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
Ngày tải lên :
25/10/2012, 10:39
... draft. JG made substantial contributions to the
data analysis. GB was substantially involved in the analysis,
interpretation and drafting the manuscript.
Acknowledgements
To the Medical Statistics ... did not affect the patient but, in these cases,
nurses administered medication without a legally valid physi-
cian order. Although an absent 'signature' with CPOE was
regarded as an error, ... full audit trail, legibility, use of approved
names, specification of key data fields such as route of admin-
istration, storage and recall of records.
Although the CPOE system recently installed...
- 6
- 526
- 0
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
Ngày tải lên :
25/10/2012, 11:10
...
Kaats GR was the principal investigator; he se-
cured and audited all study data, conducted all of the
statistical analyses, and contributed significantly to
the preparation and submission of ... investigators‟ DXA (Total Body Du-
al-energy X-ray Absorptiometry) database, from par-
ticipants at a local health fair, and from referrals from
subjects who agreed to participate. All subjects ... known as
„AlgaeCal‟ or „AC‟) made by milling whole,
live-harvested sea algae found on the South American
coastline. In addition to calcium, the algae contained
other naturally occurring minerals...
- 12
- 663
- 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
Ngày tải lên :
26/10/2012, 09:57
... Fatema Hasan
Mahatma Gandhi Mission’s Medical College, Aurangabad, Maharastra, India, 431003
Correspondence to: Hunaid Hasan or Tasneem Fatema Hasan, “Ezzi Manzil”, CTS No. 3910, Near Bombay Mercantile ... 3910, Near Bombay Mercantile
Bank, Beside Amodi Complex, City Chowk, Juna Bazaar, Aurangabad, Maharashtra, India 431001. Email:
hunaidhasan@hotmail.com or zainabhasan52@hotmail.com. Phone: +91-240-234-8673/ ... of 730 participants between
the ages of eighteen and thirty-nine years. 366 participants were from Aurangabad, India
(AUR), and 364 participants were from Mississauga, Canada (MISS). The participants...
- 12
- 757
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
Ngày tải lên :
26/10/2012, 10:04
... polymerase chain reaction. Med Sci Monit. 2001; 7:
345-9.
14. Ogawa Y, Itoh H, Nakagawa O, et al. Characterization of the
5'-flanking region and chromosomal assignment of the human
brain natriuretic ...
5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases
-1323 to -1299) and antisense, 5’-
CCCCACCAAGCCAACACAGGATGGA -3’ (bases
-919 to-895) were used to amplify a 429-bp product
from genomic DNA (Fig. 1A) . The PCR ... declared that no conflict of in-
terest exists.
References
1. Kangawa K, Matsuo H. Purification and complete amino acid
sequence of alpha-human atrial natriuretic polypeptide (al-
pha-hANP)....
- 7
- 612
- 1
Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"
Ngày tải lên :
03/11/2012, 10:09
... towards recognising the chaotic properties of natural
phenomena and the use of appropriate non-linear analysis, such as fractal analysis, in place of
traditional analyses [1].
A strong reason ... desirable control strategy. The analysis of fractal patterns in gait
and posture data may serve as an indicator of pathology or impairment. Surrogate data analysis is used
to test for a system’s ... examine appropriate data using such
techniques. In particular, a non-linear approach to the analysis of COP data may be appropriate and may
reveal information regarding a person’s control of their...
- 10
- 457
- 0
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi
Ngày tải lên :
06/11/2012, 10:35
... river basin management and/or ecosystem-based river basin
management (Nakamura, 2003). Embedded in these approaches are the concepts of
participatory management and adaptive management (Miser and ... efficiency of our actions.
1.2.3. Integrated management and policy analysis
Integrated management
Rapid changes of objectives and methodological approaches towards the management
of natural resources ... by means of the Morris analysis, as in this chapter. Examples of the
decision variables in RaMCo are the number of fish blasts, the total capacity of urban
wastewater treatment plants, and the...
- 139
- 492
- 0