don apos t hyphenate most compounds formed with the prefixes listed below connect them solidly to the base word

Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"

Ngày tải lên : 31/10/2012, 17:03

... longer primer for detection of the wt allele was 5’-TTC AAG CCC TGA TGA TAA GGT CTT TGG CAT TAG ATG CTG TTT TGT TTT-3.’ The shorter primer was 5’-CTT TTG GCA TTA GAT GCT GTT TTG TCC TG-3.’ As reverse ... exclude the possibility that the observed associations are due to apoE rather than PPARδ in our study Conflicts of interest The authors have declared that no conflict of interest exists References ... regarding the BMI affected our data the allele frequencies in patients with a BMI above the median were compared with those below the median Patient characteristics for each group are presented in table...

4
568
0

Đề Sinh vào chuyên Lê Quý Đôn - Q.T

Ngày tải lên : 08/09/2013, 17:10

1
906
2

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Ngày tải lên : 07/03/2014, 16:20

... 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the ﬁrst PCR 5¢ primer and the second ... ﬁrst PCR were: 5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGA CCCTACTCCAG-3¢ and 3¢ primer, 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively...

9
485
0

Báo cáo Y học: Shb links SLP-76 and Vav with the CD3 complex in Jurkat T cells pptx

Ngày tải lên : 24/03/2014, 04:21

... consequently how the activation of JNK is affected To further study the effects of the mutation in the Shb SH2 domain, we examined the proteins found to coprecipitate with Shb in Jurkat cells Except ... EcoRI, and ligated into EcoRI digested pGEX- 2T vector The SLP-76-Pro–GST plasmid was constructed using the primers 5¢-CGAGGGATCCCT GCAGAACTCCATCCTGCCTG-3¢ and 5¢-CATTTAAT GAATTCTCTTCCTCCGC-3¢ corresponding ... known to interact with each other, they both bind directly and independently to Shb Phosphorylation of SLP-76 and Vav is dependent on Shb with a functional SH2 domain To further study the effects...

10
408
0

Modern constitutions, a collection of the fundamental laws of twenty-two of the most important countries of the world, with historical and bibliographical notes potx

Ngày tải lên : 30/03/2014, 01:20

389
391
0

Báo cáo hóa học: "Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment" pptx

Ngày tải lên : 18/06/2014, 16:20

... characteristics Patient characteristics are shown in Table for the 22 patients treated with IFN-a 2b, the 22 patients not treated with IFN-a 2b, and the 20 healthy subjects Of the 22 treated patients, ... levels with IFN-a 2b treatment may indeed contribute to the antitumor response A better understanding of the mechanism of action of IFN-a 2b may facilitate the development of treatment strategies to ... patients with melanoma (22 patients treated in this study and the other 22 patients who were referred to our institution during the study); these data again suggest that Treg values are higher in patients...

13
642
0

Don’t Get Personal Remember that on the GRE, you must assess arguments and answer questions based pdf

Ngày tải lên : 18/06/2014, 17:20

... of the second unit tells you that you need words that contrast with intelligence and reason The third unit conﬁrms that the concepts in these contrasting words lead to understanding that is not ... of them as clues to a mystery Among the most useful of these are the words that enable you to identify the logical relationship between the complete unit(s) of the sentence and the incomplete ... You must then choose the word or phrase that is most nearly opposite the stem word The words in the antonym questions will most often represent concepts You are looking, then, for the concept among...

25
390
0

Easy PHP websites with the zend framework (w jason gilmore) (2011)(t)

Ngày tải lên : 23/06/2014, 13:03

... back from the laptop and take the time to learn how to develop software rather than merely write code One of the first actionable steps I took in this quest was to embrace what was at the time a ... common testing scenarios which relate to the material covered in the chapter, complete with a sample test Further, Chapter 11 is entirely devoted to the topic of configuring PHPUnit to work with ... complete breakdown of what's possible Testing Your Work Testing is such an important part of the development process that I didn 't want to treat the topic as an afterthought At the same time, it...

236
391
1

cpanel user guide and tutorial get the most from cpanel with this easy to follow guide

Ngày tải lên : 03/07/2014, 16:05

... why they are so important • How to use cPanel to back up the data in your account • Automated backup methods • How to use cPanel to restore the data that you've backed up • What to if you not have ... features than you see in the screenshot Also, it is possible that your web host uses a different cPanel theme To see some other cPanel themes, please turn to Chapter 12 At the extreme top right ... something that only those with reseller web hosting accounts have access to The first two will be checked by default Leave the checkboxes as they are and then click Install to start the installation...

208
1.7K
0

Báo cáo y học: " γ δ Vγ9/Vδ2 T lymphocytes in Italian patients with Behçet’s disease – evidence for expansion, and tumour necrosis factor receptor II and interleukin-12 receptor β1 expression in active disease" pptx

Ngày tải lên : 09/08/2014, 01:23

... they are the first line of host defence and control epithelial cell growth, thus participating in the maintenance of epithelial integrity [10,11] In particular, it has been postulated that they recognize ... anti-Vδ2 TCR FITC simultaneously We also evaluated the expression of these receptors after stimulation of Vγ9/Vδ2 cells with phosphoantigens with and without the addition of exogenous human TNF-α ... γ/δ T cells have been reported to produce several cytokines, with the cytokine profile dependent on the nature of the immune response They also produce a panel of chemokines that may attract inflammatory...

7
373
0

Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx

Ngày tải lên : 09/08/2014, 08:22

... Among the numerous autoantigens described, the nucleosome represents an important target structure of the autoimmune attack, leading to the formation of a wide array of autoAbs directed to single ... declare that they have no competing interests Authors' contributions RF participated in the design of the study, worked with the T cell cultures and drafted the manuscript DM performed the T cell ... observation) and, importantly, autoAbs to hnRNP-A2 are, together with anti-Sm antibodies, among the earliest detectable autoAbs in MRL/lpr mice, where they were found to precede anti-dsDNA autoAbs...

10
395
0

Báo cáo y học: "Lymphopenia is an important prognostic factor in peripheral T-cell lymphoma (NOS) treated with anthracycline-containing chemotherapy" docx

Ngày tải lên : 10/08/2014, 21:23

... performed at the time of diagnosis and prior to treatment No patients showed clinical signs of severe infection at the time of laboratory testing The study protocol was approved by the institutional ... used to predict treatment outcomes or further stratify patients with the same IPI scores Castillo et al reported that a PIT score > and lymphopenia were independent prognostic factors for predicting ... treated with similar chemotherapy regimens The objective of this study was to retrospectively investigate whether lymphopenia is a predictive marker for survival in patients with PTCL-NOS treated...

9
312
0

báo cáo khoa học: "An unusual presentation of precursor T cell lymphoblastic leukemia/lymphoma with cholestatic jaundice: case report" pot

Ngày tải lên : 10/08/2014, 22:20

... precursor TALL After having considered the highly deranged liver function tests, per the recommendations of the treating oncologist, the treatment was initiated with cisplatin and dexamethasone ... likely to be malignant than those found in the other mediastinal compartments [10] Thymomas are the most common anterior mediastinal primary neoplasms in adults [11] Symptoms due to myasthenia ... competing interests Authors' contributions KP and SL assembled, analyzed and interpreted the patient data regarding the hematological disease All authors contributed to writing the manuscript All...

6
338
0

Báo cáo y học: "Unusual association of ST-T abnormalities, myocarditis and cardiomyopathy with H1N1 influenza in pregnancy: two case reports and review of the literature" pps

Ngày tải lên : 10/08/2014, 23:22

... copy of the written consent is available for review by the Editor-in-Chief of this journal Acknowledgements The authors would like to thank both our patients for consenting to let us write this ... Hatfield, UK Page of Authors’ contributions KC drafted the manuscript and researched the case DM supervised the drafting of the report, revised the draft copy of the manuscript and reviewed the ... healthy patients and evolve in few hours to a severe ARDS with a refractory hypoxemia needing recourse to ECMO in 5% to 20% of patients is novel [16,17] The first publications of patients admitted...

5
418
0

Báo cáo y học: " Biliary peritonitis caused by a leaking T-tube fistula disconnected at the point of contact with the anterior abdominal wall: a case report" docx

Ngày tải lên : 11/08/2014, 21:22

... fistula tract opening (a) T- tube fistula tract opening Intraoperative laparoscopic photograph illustrating opening to T- tube fistula tract (arrow) with diagrammatic representation of relation to ... choledochotomy) In the past, this was rarely advised as it was thought to increase the risk of stricture formation and Duration of T- tube insertion Many factors may affect the risk of symptomatic bile ... latex T- tubes, as the former take longer to form a mature tract [8] In our case, therefore, the standard latex T- tube used is unlikely to be of aetiological significance Immune system The hypothesis...

4
439
0

Báo cáo y học: "Recently published papers: Clunk-click every trip, smile, but don’t stop for a drink on the way" ppt

Ngày tải lên : 12/08/2014, 20:20

... Swiss intensivists to rate the importance of 19 factors associated with patients or the intensive care setting, and respond to eight hypothetical scenarios, each of factorial design Their prime ... intratracheal doses of a recombinant surfactant protein C-based surfactant given within 24 hours They failed to demonstrate any difference between control and treatment groups with regard to ... Interestingly, the Kaplan–Meier curves of time to death appear to separate at around the time of tracheotomy in the delayed group How confident can projections of required ventilatory support...

3
317
0

Báo cáo y học: "Three dimensional structure directs T-cell epitope dominance associated with allergy" pptx

Ngày tải lên : 13/08/2014, 13:22

... conformational flexibility and to investigate the mechanism, the profiles of flexibility/stability and epitope score were tested for correlation at various offsets of one dataset to the other The ... presentation of allergenic epitopes (Fig 7) The model illustrates the presentation of two epitopes but it is not intended to suggest that both epitopes are presented from every molecule, nor is it ... adjacent epitope The bias toward dominance of epitopes on the C-terminal side of flexible sites in Ves v suggests that a feature of either the loading mechanism or the structure of the protein...

12
298
0

MỘT số PHẢN ỨNG HÓA HỌC TẠO RA đơn CHẤT THƯỜNG gặp

Ngày tải lên : 10/09/2014, 13:02

... O2 (xuc tac: KOH) ́ ́ *phan kim loa i tac dung v muôi ̉ ng ̣ ́ ̣ i ́ ví du: ̣ Fe + CuSO4 → FeSO4 + Cu Cu + 2AgNO3 → Cu(NO3)2 + 2Ag *phan kh ̉ ng oxit kim loa i: cac oxit cua kim loai trung binh, ... ́ ̉ ̣ ̀ ́ ví du: ̣ 2Al + Fe2O3 → 2Fe + Al2O3 (xuc tac:nhi t đ ̣ ) ́ ́ ̣ ô H2 + CuO → H2O + Cu FeO + CO → Fe + CO2 2ZnO + C → 2Zn + CO2 *m t số phan kha c ̣ ̉ ng ́ NaCl + H2O ( đ pdd k mang ... 2H2O (xuc tac: CuCl2, 400¤C) ́ ́ 4HBr + O2 → 2Br2 + 2H2O 4HBr + MnO2 → MnBr2 + Br2 + 2H2O 2AgCl → 2Ag đen + Cl2 (xuc tac: anh sang) ́ ́ ́ ́ H2S + Cl2 → S + 2HCl 2NaClO → 2NaCl + O2 ( t

3
15.3K
276

a study of hedging devices in conversations in gone with the wind by margaret mitchell = nghiên cứu các phương tiện rào đón trong các cuộc hội thoại của tác phẩm cuốn theo chiều gió của nhà văn margaret mitchell

Ngày tải lên : 02/03/2015, 14:19

... other acts that may be seen as beneficial to the addressee (e.g promises) In addition, they may also be used to stress speaker‘s commitment to the truth of their utterance or to suggest that they ... ―negation + intensifier‖ approximators, the subtable shows that there are five items in total with 106 tokens Not so and its variation contributed 37 tokens, making up 34.9 of the total rate, ... likely to be the sources of hedging than the other‖ (Bashanova, 2012: 29) With regards to the taxonomy of hedging functions, it was decided to adapt Hyland‘s theory, mainly for the fact that it may...

52
843
4

Giáo án bồi dưỡng thao giảng, thi giáo viên hoá học lớp 8 Bài 6 Đơn chất và hợp chất - phân tử (20)

Ngày tải lên : 20/05/2015, 17:41

... Kiểm tra 15 ph t Câu (7,5 đ) Trong ch t sau, ch t đơn ch t ? Ch t hợp ch t? Giải thích ? a, Khí ozon t o nên t nguyên t oxi b, Khí amoniac t o nên t nguyên t N H c, P đỏ t o nên t nguyên t ... kích thước h t hợp thành mẫu ch t? ? Em có nhận x t h t hợp thành KL đồng nói riêng đơn ch t KL nói chung? T mô hình t ợng trưng mẫu ch t tính PTK đơn ch t H2, O2; hợp ch t: nước, muối ăn Bài t p ... cacbonat t o nên t nguyên t Ca, C O e, Kim loại Magie t o nên t nguyên t Mg Câu (2,5 đ) ? Hợp ch t có phải hỗn hợp không? Vì sao? Mô hình t ợng trưng số mẫu ch t ? Em có nhận x t thành phần,...

7
301
0