does pharmacotherapy have a place in the weight management of patients with type 2 diabetes
Báo cáo y học: " A comparison of olanzapine and risperidone on the risk of psychiatric hospitalization in the naturalistic treatment of patients with schizophrenia" ppsx
... days of hospitalization at the end of each of the 12 months post initiation indicated that the average number of hospitalization days for the RIS-treated patients was 1.4 to 2. 1 times that of the ... values, inconsistent data, claim duplicates, and unexpected missing values The SCAP database is similar to other administrative and pharmacy claims database, as it provides detailed information about ... that used in a recent study of hospitalization rates in patients with schizophrenia [22 ] Analyses did not adjust for adherence with medication because the analytical sample included participants...
- 11
- 521
- 0
báo cáo hóa học:" Survivin gene levels in the peripheral blood of patients with gastric cancer independently predict survival" doc
... several factors First of all, the inclusion in our multivariable analysis (with a stepwise mode of variable selection) of a marker Table 3: Multivariate survival analysis of 70 patients with gastric ... Oncol 20 08, 15:3073-30 82 Psaila B, Lyden D: The metastatic niche: adapting the foreign soil Nat Rev Cancer 20 09, 9 :28 5 -29 3 Hiraiwa K, Takeuchi H, Hasegawa H, Saikawa Y, Suda K, Ando T, Kumagai K, ... gastrointestinal and pancreatic carcinomas Virchows Arch 20 01, 439:109-117 Koga T, Tokunaga E, Sumiyoshi Y, Oki E, Oda S, Takahashi I, Kakeji Y, Baba H, Maehara Y: Detection of circulating gastric cancer...
- 8
- 565
- 0
báo cáo hóa học: " Fear of hypoglycaemia: defining a minimum clinically important difference in patients with type 2 diabetes" docx
... 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 patients with type diabetes mellitus JAMA 20 09, 301:1565-15 72 American Diabetes Association Workgroup on Hypoglycemia: Defining and reporting ... to the study with either a combination of metformin and a glitazone, or with a combination of metformin and a sulphonylurea Patients were not eligible if they had been treated with insulin in the ... JB, Mayer BD, Heine RJ, Holman RR, Sherwin R, et al.: Management of hyperglycemia in type diabetes: a consensus algorithm for the initiation and adjustment of therapy Diabetes Care 20 06, 29 :1963-1972...
- 8
- 363
- 0
báo cáo hóa học: " Additional impact of concomitant hypertension and osteoarthritis on quality of life among patients with type 2 diabetes in primary care in Germany – a cross-sectional survey" doc
... suffer from type diabetes Quality of life (QoL) in patients with diabetes is reduced and patients are impaired in nearly all domains of daily life [2, 3] In addition patients with diabetes are more ... The authors are grateful to the AOK Sachsen-Anhalt and the AOK Rheinland-Pfalz for support in sending out the study material to their insured and for the preparation of claims data for sampling ... cross-sectional survey among patients with type diabetes has been conducted as part of the ELSID study (Evaluation of a Large Scale Implementation of Disease Management Programmes for patients with type diabetes) ...
- 7
- 458
- 0
báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx
... 'strongly agree' to each of the 20 ITAS items are shown in Table 3, for insulin-naïve and insulin-treated patients The mean total ITAS score of the insulin-naïve patients was about one standard deviation ... appraisal scale (ITAS) in both insulin naïve and insulin-treated type diabetes patients Factor analyses suggest a simple twofactor structure, with items pertaining to a positive and a negative appraisal ... 6% of the insulintreated agrees to fearing injections compared to 47% of the insulin-naïve participants ingly, post-hoc analyses revealed that both among the insulin treated as well as the insulin-naïve...
- 7
- 602
- 0
báo cáo hóa học:" Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" pdf
... 'strongly agree' to each of the 20 ITAS items are shown in Table 3, for insulin-naïve and insulin-treated patients The mean total ITAS score of the insulin-naïve patients was about one standard deviation ... appraisal scale (ITAS) in both insulin naïve and insulin-treated type diabetes patients Factor analyses suggest a simple twofactor structure, with items pertaining to a positive and a negative appraisal ... 6% of the insulintreated agrees to fearing injections compared to 47% of the insulin-naïve participants ingly, post-hoc analyses revealed that both among the insulin treated as well as the insulin-naïve...
- 7
- 485
- 1
báo cáo hóa học:" Fear of hypoglycaemia: defining a minimum clinically important difference in patients with type 2 diabetes" docx
... 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 patients with type diabetes mellitus JAMA 20 09, 301:1565-15 72 American Diabetes Association Workgroup on Hypoglycemia: Defining and reporting ... to the study with either a combination of metformin and a glitazone, or with a combination of metformin and a sulphonylurea Patients were not eligible if they had been treated with insulin in the ... JB, Mayer BD, Heine RJ, Holman RR, Sherwin R, et al.: Management of hyperglycemia in type diabetes: a consensus algorithm for the initiation and adjustment of therapy Diabetes Care 20 06, 29 :1963-1972...
- 8
- 337
- 0
Báo cáo khoa học: "Intraoperative frozen section assessment of sentinel lymph nodes in the operative management of women with symptomatic breast cancer" ppt
... processing and review Any remaining sentinel nodal tissue after frozen sectioning were fixed in formalin and embedded in paraffin with subsequent examination by H&E staining (again an average of ... intraoperative analysis of sentinel node status was particularly advantageous for those with larger tumors Furthermore, the accurate, intraoperative selection of 23 of the 30 patients with axillary metastases ... immediate, intraoperative FS assessment of the SLN were then compared with that of their delayed formal pathological examination with regard to nodal oncological status ANOVA testing was used to examine...
- 6
- 384
- 1
Báo cáo y học: "Expression of bioactive bone morphogenetic proteins in the subacromial bursa of patients with chronic degeneration of the rotator cuff" pptx
... TTTGGGGCCAAGTTTTTCTG down BMP -2 up ACAGGAACTTCCGGGTCAAT up GGGAAAACAACCCGGAGATT down TTAAGGCGTTTCCGCTGTTT FGF -2 up TACAACTTCAAGCAGAAGAG down CAGCTCTTAGCAGACATTGG VEGF up AAGTGGTCCCAGGCTGCA down ATCTCTCCTATGTGCTGGCC ... ATCTCTCCTATGTGCTGGCC up AAGCAGCCATGGCAGAAGTA 4 82 60 37 [NCBI: M15840] down GAACACCACTTGTTGCTCCA up GAGTGACAAGCCTGTAGCCCATGTTGTAGCA 444 60 37 Clontech down GCAATGATCCCAAAGTAGACCTGCCCAGACT IL-1 TNF- The ... Exp Clin Med 20 00, 25 : 125 -134 17 Gotoh M, Hamada K, Yamakawa H, Yanagisawa K, Nakamura M, Yamazaki H, Ueyama Y, Tamaoki N, Inoue A, Fukuda H: Interleukin-1 induced subacromial synovitis and shoulder...
- 9
- 412
- 0
Báo cáo y học: " Dimensionality and scale properties of the Edinburgh Depression Scale (EDS) in patients with type 2 diabetes mellitus: the DiaDDzoB study" pot
... participated in the design of the study, and helped in writing the manuscript All the authors have read and approved the final manuscript Competing interests The authors declare that they have ... Type Diabetes: recommendations for standard, comprehensive, and minimal care Diabetic Medicine 20 06, 23 :579-593 14 American Diabetes Association: Standards of Medical Care in Diabetes2 009 Diabetes ... (mean HbA1c 6.7%) and the majority was being treated with a combination of diet and oral agents Males and females differed significant ly regarding several demographic and clinical variables (Table...
- 19
- 488
- 0
Báo cáo y học: "Midregional pro-Adrenomedullin in addition to b-type natriuretic peptides in the risk stratification of patients with acute dyspnea: an observational study" ppt
... of data, analysis and interpretation of data, and critical revision of the manuscript for important intellectual content NGM, AB, and HF participated in analysis and interpretation of data, and ... had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis TB, TR, MN, NS, LB, HU, RB, and MC participated in acquisition ... Laboratories, Abbott Park/IL, USA) [22 ] Statistical analysis Continuous variables are presented as mean ± standard deviation or median (with interquartile range), and categorical variables as...
- 11
- 321
- 0
Báo cáo y học: "Exogenous glucagon-like peptide-1 attenuates the glycaemic response to postpyloric nutrient infusion in critically ill patients with type-2 diabetes" ppsx
... 50% of patients with pre-existing type- 2 diabetes • Further study with an increased dose, administration during intragastric feeding, and/or administration with insulin warrants evaluation Abbreviations ... syndrome: impact of incretin-based therapies Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy 20 10, 3 :22 7 -24 2 29 Muller WA, Faloona GR, Aguilar-Parada E, Unger RH: Abnormal alpha-cell ... postprandial glycemia J Clin Endocrinol Metab 20 10, 95 :21 5 -22 1 12 Streiner DL: The case of the missing data: methods of dealing with dropouts and other research vagaries Can J Psychiatry 20 02, 47:68-75...
- 11
- 338
- 0
The assessment of public knowledge on diabetes mellitus and patient reported outcomes measurement among patients with type 2 diabetes in thailand
... In order to improve the quality and standards of the national healthcare system, the National Health Security Act was enacted in Thailand in 20 02. (22 ) Realizing the growing burden of T2DM that ... Similarly, DM was the fourth leading cause of death, accounting for 5% of all causes of death in Thailand in 20 02 Being a chronic disease with many devastating complications, DM naturally places ... (T2DM)…………………… 2 1 .2 The role of disease management in containing the T2DM epidemic ………4 1.3 T2DM management in Thailand: the state of affairs………………………….5 1.4 Prevention: the cornerstone of T2DM management ……………………….6...
- 194
- 460
- 0
Effectiveness of PRECEDE model for health education on changes and level of control of HbA1c, blood pressure, lipids, and body mass index in patients with type 2 diabetes mellitus docx
... cardiopathies such as angina, acute myocardial infarction (AMI), and cerebrovascular accident (CVA), diabetes mellitus complications (microvascular, macrovascular, neuropathy), and the type of ... required was 596 patients (29 8 in each arm) Statistical analysis First, a descriptive analysis was carried out for each variable included in this study, involving the mean and SD for the quantitative ... et al [20 ], and Shibayama et al [21 ], which were included in the meta-analysis carried out by Duke et al [9] In the latter study, the mean adjusted reduction, when compared with the usual management, ...
- 9
- 654
- 1
báo cáo hóa học:" Health-related quality of life and self-related health in patients with type 2 diabetes: Effects of group-based rehabilitation versus individual counselling" pot
... evaluate physical functioning in type diabetes patients in a broad, comprehensive manner [24 ,25 ] If patients skipped a question in the questionnaires the missing value was calculated as an average ... provided input into the main ideas of this paper All authors obtained funding for the project ESV carried out screening, randomization and examination of the patients, and performed part of the statistical ... Spuur for laboratory assistance We thank the staff at the healthcare centre and the diabetes outpatient clinic for participating in the study Author details Department of Endocrinology and Gastroenterology,...
- 8
- 369
- 0
Báo cáo y học: "Efficacy of lifestyle interventions in physical health management of patients with severe mental illness" doc
... many pharmacological approaches are available for reducing or delaying diabetes mellitus [35], but a key piece for the initial management of the disease for the majority of the affected population ... established, and the addition of a pharmacological treatment increases the rate of quitting Conclusions The physical health of patients with SMI should be part of the field of action of psychiatric ... placebo in decreasing fasting glucose, insulin levels, and IRI levels All three intervention groups were found to have a significant advantage over placebo in improving weight gain and insulin...
- 10
- 413
- 0
báo cáo khoa học:" Health-related quality of life and self-related health in patients with type 2 diabetes: Effects of group-based rehabilitation versus individual counselling" docx
... evaluate physical functioning in type diabetes patients in a broad, comprehensive manner [24 , 25 ] If patients skipped a question in the questionnaires the missing value was calculated as an average ... consideration of quality of life [4] However, there is a growing interest in the assessment of health-related quality of life (HRQOL) in type diabetes An increasing number of type diabetes trials, including ... analysed using a two-way analysis of variance with adjustment for baseline values in SAS, version 9.1 (Cary, NC) The study statistician performing the data analyses was blinded to patients assignment...
- 21
- 332
- 0
Báo cáo khoa học: " Pulse pressure variation: beyond the fluid management of patients with shock" pot
... Critical Care Vol 11 No Michard et al Figure Patients who have reached the plateau of the Frank–Starling relationship can be identified as patients in whom PPV is low The clinical and intraoperative ... pressure variation (PPV) is a marker of the position on the Frank–Starling curve, not an indicator of blood volume or a marker of cardiac preload Increasing preload induces a decrease in PPV (from ... PPV is mimimal when the heart is operating on the plateau of the Frank–Starling curve (➌ and ➍) Decreasing preload induces an increase in PPV (from ➋ to ➊), also increasing contractility (from...
- 3
- 270
- 0
Tài liệu A Place in the Sun pptx
... a moment the Captain said nothing Distantly, you could hear the hum of the subspace drive-unit and the faint whining of the stasis generator Then the Captain bolted out of bed after unstrapping ... completely The pain was a numb thing now, far away, hardly a part of himself Maybe Mayhem was absorbing the pain-sensation for him, he thought Maybe Mayhem took the pain and suffered with it in the shared ... Maybe Mayhem can find out and something about it." "Yeah, maybe That's a hell of a way to risk the life of the most important man in the Galaxy Because if Mayhem boards that ship and can't anything...
- 26
- 488
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25