dna recombinant protein and xiap induce higher level of cd8 t cell immune responses
Báo cáo sinh học: "Improve protective efficacy of a TB DNA-HSP65 vaccine by BCG priming" pdf
Ngày tải lên :
14/08/2014, 19:22
... relevant to the modulation of immune responses after challenge than is the route of BCG administration Despite the fact that BCGin /DNA immunization clearly induced greater protection than did BCGsc /DNA ... Genetic Vaccines and Therapy 2007, 5:7 tion of state -of- the-art vaccine technology and new strategies A new vaccine against TB would need to induce protection superior to that elicited by the ... soluble mediators, such as transforming growth factor-β, or by cell- cell contact mediated by regulatory T cells, although this has yet to be investigated It is also of note that TNFα levels were...
- 14
- 144
- 0
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc
Ngày tải lên :
08/03/2014, 16:20
... TGTCCCTGCTAGTTGTCATTTGG ACGACCACTTTGTCAAGCTCATT TGAGGTCCACCACCCTGTTG TCCTGAAACGCCTTCGGAAGAG CCATTGGGTTGAAGGCATTCG ACAAGGCCCCTGGCTGCT CCTGTCAAAAGAATAAACAGCGGTT CACTGTTCCCTCAGCCGAGGAC CCAACTCCTGATCGGCAGAAGC ... course of TNFa induction, as well as the levels of 5¢-A, 5¢-B and 5¢-C transcripts Total amount of a1,3GalT transcripts started to rise h after the addition of TNFa, to reach a plateau after h of ... AP-1/GATA motif is located just upstream of the start site (at nucleotide 1633) of transcript 5¢-A This start site is part of an octanucleotide that is highly similar to the consensus transcriptional...
- 10
- 444
- 0
Báo cáo y học: "Regulation of catabolic gene expression in normal and degenerate human intervertebral disc cells: implications for the pathogenesis of intervertebral disc degeneration" ppt
Ngày tải lên :
09/08/2014, 14:20
... CAAAC TGGTGGTCTTGTTGCTTA AAGTTC CCAATCCCTTTATTACCC [GenBank: NM_000594] TNF receptor AATTCTGGCTTCTAGTCT GGT AACGTGCCAGTGTGGAG TGA TTCAGTCCCACTCCAGG CTTCACCC [GenBank: NM_001065] TNF receptor PDAR ... ACCACTGTTCTCTTCTCT ACCCTGCCC [GenBank: NM_000575] IL-1β CGGCCACATTTGGTTCT AAGA AGGGAAGCGGTTGCTCA TC ACCCTCTGTCATTCG [GenBank: NM_000576] IL-1 receptor I ATTTCTGGCTTCTAGTCT GGT AACGTGCCAGTGTGGAG TGA ... PDAR PDAR MMP-3 TGAAGAGTCTTCCAATC CTACTGTTG CTAGATATTTCTGAACAA GGTTCATGC TTTGCTCAGCCTATCCAT [GenBank: NM_002422] MMP-9 CCCGGAGTGAGTTGAAC CA CAGGACGGGAGCCCTA GTC TACGTGACCTATGACATC [GenBank: NM_004994]...
- 10
- 678
- 0
Báo cáo y học: "DHEA-dependent and organ-specific regulation of TNF-α mRNA expression in a murine polymicrobial sepsis and trauma model" pps
Ngày tải lên :
13/08/2014, 18:22
... 322 IL-10 tgctatgctgcctgctctta gctccactgccttgctctta 405 GAPDH accacagtccatgccatcac tccaccaccctgttgctgta 452 Results Clinical status and survival The activity score of mice in sham-operated groups ... the interpretation of data MG carried out the design of the study, scored the activity of mice and contributed to the interpretation of data Acknowledgements The authors thank Claudia Pütz for ... et al Authors' contributions TB made substantial contributions to the data interpretation, performed the experiments statistical analysis and drafted the manuscript FH and CK participated in the...
- 9
- 319
- 0
Báo cáo khoa học: Identification and characterization of novel PKA holoenzymes in human T lymphocytes pdf
Ngày tải lên :
16/03/2014, 18:20
... activity in Cb2-transfected 29 3T cells was precipitated Taken together it is therefore reasonable to assume that Cb2 activity may constitute more than 20% of total PKA activity in T- cells It ... one-third of the PKI-inhibited activity was released into the extract, indicating that the precipitated Cb2 colocalized with Ca1 on RIa and RIIa in a ratio of : Of the total PKA kinase activity, ... present in the Cb2-transfected cells and not in the Ca1 or mock transfected cells This demonstrated the specificity of anti-Cb2(SNO103) in immunoblots because the 40 kDa protein band of cells...
- 9
- 406
- 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
Ngày tải lên :
07/03/2014, 12:20
... 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... CLS GTS GCS 61 61 61 16 16 16 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC...
- 16
- 397
- 0
Báo cáo khoa học: Sp1 and Sp3 are involved in up-regulation of human deoxyribonuclease II transcription during differentiation of HL-60 cells pptx
Ngày tải lên :
23/03/2014, 17:21
... )151 to )129 5¢-CCCGTCGTGGTATTGGTCTGGGC-3¢ )89 to )64 5¢-CGCGTCTCGGGGGAGTAGTCTGTACC-3¢ )89 to )64 5¢-CGCGTCTCGGTTTAGTAGTCTGTACC-3¢ )61 to )36 5¢-CGTGATGTCCCCGCCCCGGTTCCCAG-3¢ )61 to )36 5¢-CGTGATGTCCCAAACCCGGTTCCCAG-3¢ ... different mutants are shown on the left, the GC box mutated being indicated by a cross The luciferase activity of the mutant constructs is expressed relative to that of the wild-type construct (relative ... in PMA-treated cells This result could be attributed, at least partly, to significantly increased levels of Sp1 and Sp3 proteins in PMA-treated cells (Fig 5) Up-regulation of Sp1 protein levels...
- 8
- 447
- 0
Báo cáo y học: "Methotrexate enhances the anti-inflammatory effect of CF101 via up-regulation of the A3 adenosine receptor expression" doc
Ngày tải lên :
09/08/2014, 08:23
... support the notion that the anti-inflammatory effect of MTX is attributed more to adenosine than to tetrahydrolate MTX increases the extracellular concentration of adenosine, where it is known to ... demonstrated that the CD4+ T cells are the subpopulation of cells that over-express the receptor Taken together, it may be concluded that A3AR upregulation is a characteristic of activated cells, and ... as compared with the control group and each of the other treatment groups (Figure 1a) In the therapeutic treatment study, in which all of the treatments were initiated at the onset of disease,...
- 12
- 396
- 0
Ceftriaxone-induced up-regulation of cortical and striatal GLT1 in the R6/2 model of Huntington’s disease pps
Ngày tải lên :
10/08/2014, 05:21
... symptomatic [17] Effects of ceftriaxone treatment in cortical and striatal GLT1 expression Although saline-treated R6/2s showed no loss of either cortical or striatal GLT1 relative to WT at weeks ... regulating immune responses and cell survival [18] Translocation of the NF-kB complex to the cell nucleus appears to be critical for the action of ceftriaxone [19], and our results suggest that this ... collected and analyzed data, helped with data interpretation, and drafted the manuscript ALP helped with data collection, analysis, and interpretation SJB performed statistical analyses and genotyping,...
- 5
- 380
- 0
Báo cáo y học: " Cellular stress-induced up-regulation of FMRP promotes cell survival by modulating PI3K-Akt phosphorylation cascades" pdf
Ngày tải lên :
10/08/2014, 05:21
... antisense strands as follows: CCGGGCGTTTGGAGAGATTACAAATCTCGAGATTTGTAATCTCTCCAAACGCTTTTT As a control, non-target shRNA control vector was used (Sigma, SHC002) and its stem and loop structure is ... CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT (2) in vitro shRNA virus transduction shRNA virus was used at 50 multiplicity of infection (MOI) for transduction Briefly, cells were incubated ... protein level of FMRP (Figure 1C-D) suggesting that etoposide treatment results in a transcriptional up-regulation of Fmr1 mRNA that leads to increased FMRP protein level In this study, the time...
- 15
- 463
- 0
Báo cáo y học: "Stanniocalcin-1 promotes tumor angiogenesis through up-regulation of VEGF in gastric cancer cells" ppt
Ngày tải lên :
10/08/2014, 05:21
... considered to be statistically significant Additional material Additional File 1: Construction of plasmids and verification of transfected BGC cells (A) Cells were transiently transfected with STC-1 ... suggests thatSTC1-induced tumorigenesis is not through enhancing cell proliferation directly There might be other mechanisms that promote tumorigenesis It is well known that the development of tumors ... immunoblotted with antibodies to phosphorPKC bII, total PKC bII, phosho-P38 and total P38 The results are representative of three independent experiments (D) Concentration courses of ERK1/2 activation...
- 9
- 404
- 0
Báo cáo y học: " Smoking-mediated up-regulation of GAD67 expression in the human airway epithelium" doc
Ngày tải lên :
12/08/2014, 11:22
... exposure within the linear range of detection The contrast was inverted, the pixel intensity of each band determined, and the background pixel intensity for a negative area of the film of identical ... Interestingly, the effect of nicotine was blocked both by the nicotinic antagonists and by the GABA-A receptor antagonists This suggests that the sequential activation of nicotinic signaling ... regulated at the post-translational level by protein phosphorylation, palmitoylation and cleavage [39] Together, these findings suggest that cigarette smoking may have a complicated effect on...
- 15
- 369
- 0
Up regulation of c EBPa in hepatocellular carcinoma is correlated to poorer prognosis
Ngày tải lên :
02/10/2015, 17:14
... GGGGTACTTTATCACGCCCTG TGTATACCCCTGGTGGGAGA GGACTTCGAGCAAGAGATGG Reverse Primer (5'-3') TTTGCGGTCAGTTCCTGAGC AATGGGCTGGGAATAGTAGGT GGGAATCCCGTTCTCATCAGA TCATAACTCCGGTCCCTCTG AGCACTGTGTTGGCGTACAG The following ... in the rotor of the LightCycler Table 3.2 List of primers used in RT-PCR Gene HOXB7 NRG2 SLC29A2 C/EBPA B-actin Forward Primer (5'-3') CGAGTTCCTTCAACATGCACT CAGTCACAAGTCGTTTTGCCT GGGGTACTTTATCACGCCCTG ... different patients might require different treatment strategies Thus, in order to better manage HCC patients’ surgical and chemotherapeutic treatment according to their individual risk; it is important...
- 84
- 154
- 0
Tài liệu Báo cáo Y học: Uncoupling of protein-3 induces an uncontrolled uncoupling of mitochondria after expression in muscle derived L6 cells ppt
Ngày tải lên :
21/02/2014, 15:20
... expressed without perturbing the normal protein expression pattern of the L6 cells Figure shows that, in fact, the protein expression patterns of cells infected with either control (empty) viruses ... and the control b-Gal adenovirus particles at the moment of cells transduction Infection of L6 cells with the adenovirus particles was performed with the help of the transfection reagent Lipofectamine ... observed These uncoupling effects were the result of overexpression of the recombinant proteins leading to a compromised mitochondrial integrity rather then to an intrinsic property of the proteins This...
- 9
- 467
- 0
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx
Ngày tải lên :
22/02/2014, 07:20
... findings, together with previous reports in the literature regarding other immune cell types at different stages of maturation and activation, indicate that this signaling system might be regulated in ... endocannabinoidmediated T cell dendritic cell communication Finally, the presence of relatively high amounts of PalEtn in both immature and mature dendritic cells might indicate that the strong anti-inflammatory ... endocannabinoid inactivation The heterogeneous distribution of CB2 receptors among cells of the immune system suggests that these receptors might exert their function on immune cells depending on their lineages...
- 8
- 645
- 0
Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx
Ngày tải lên :
07/03/2014, 03:20
... Arabidopsis thaliana indicated that both proteins can be detected throughout the plant and that expression does not appear to be restricted to photosynthetic tissue, even though absolute expression levels ... undoubtedly the central protein of the translocon It is not only the largest, most abundant and best studied of all Tic proteins, but also probably the only component involved in translocation steps ... function Tic component Isoforms in A thaliana (AGI) Tic110 Tic62 Tic55 Tic40 AtTic110 (At1g06950) AtTic62 (At3g18890) AtTic55 (At2g24820) AtTic40 (At5g16620) Tic32 AtTic32-IVa (At4g23430) AtTic32-IVb...
- 11
- 491
- 0
Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf
Ngày tải lên :
15/03/2014, 00:20
... shown to inactivate TIMP-1 [38] Thus, it appears that peroxynitrite potentiates MMP activity not only by the direct activation of proMMPs, but also by preservation of MMP activity after it is ... activity protected the dopaminergic cells from apoptosis Inhibition of the MMP-3 activity attenuated the activation of caspase-3, the executioner enzyme in apoptosis By contrast to the apoptosis-promoting ... processing of gelatin One of the products generated when GSH reacts with peroxynitrite is GSNO2 It was shown that this product most likely activates the proenzymes through S-glutathiolation of the cystein...
- 18
- 463
- 0
Báo cáo Y học: Regulation of peptide-chain elongation in mammalian cells pptx
Ngày tải lên :
23/03/2014, 21:20
... (see text for details) and leading to phosphorylation and inactivation of eEF2 Modest depletion of cellular ATP (which causes AMP levels to rise), or the direct activation of the AMP-activated protein ... although it might affect its interaction with eEF1A or other proteins Another GEF involved in translation initiation provides a precedent for this – the phosphorylation of two sites in the extreme ... expression of a dominant-interfering mutant of AMPK [63] These data strongly suggest that the AMPK mediates the effects of modest ATP depletion on the phosphorylation of eEF2 AMPK does not directly...
- 9
- 469
- 0
Report on the Regulation of Reproductive Cell Donation in the European Union potx
Ngày tải lên :
28/03/2014, 16:20
... Although the Act of Status and Rights of Patients requires that mutual understanding be a requisite for patient treatment, explicit consent of the patient in everyday healthcare procedures is not required ... reproductive cell donation The donor may withdraw consent up until the time of fertilization SI Article 25 of the Law governing the status of reproductive cell donation states: “Donation of spermatozoa and ... 03.12.05) set up a National Registry of authorised institutions that can apply techniques of medically-assisted procreation This Registry is held by the National Institute of Health (L’Istituto Superiore...
- 21
- 302
- 0
Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf
Ngày tải lên :
30/03/2014, 08:20
... activity in the constitutive pathway, and that the CT-peptide appears to act as an inhibitor Direct inhibition of PC1 ⁄ enzymatic activity by a CT-peptide has been tested previously in vitro, ... irrespective of the amount of CT-peptide used up to lm, at pH 7.8 could be related to its capacity to activate the enzyme Alternatively, this may well be due strictly to a stabilizing effect induced by the ... we found that the CT-peptide is able to activate PC1 ⁄ when present at low concentration, although inhibiting it at high concentration Hence, in addition to the demonstrated role of the proregion...
- 10
- 305
- 0