display 3 1 a predefined function that returns a value 2 of 2

Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx

... identification of the major nuclear matrix proteins Proc Natl Acad Sci USA 19 91, 88 :1 0 31 2 -1 0 31 6 32 Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y: Bipartite nuclear localization signal of matrin ... 20 09, 28 :2 2 31 -22 43 20 Marcello A, Lusic M, Pegoraro G, Pellegrini V, Beltram F, Giacca M: Nuclear organization and the control of HIV -1 transcription Gene 20 04, 32 6 :1- 11 21 Marcello A, Ferrari A, ... Pools of siRNAs were obtained from Dharmacon: MATR3 siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1...

15
470
0

Chuong I - ĐẶC ĐIỂM CỦA CÔNG TRÌNH CRESCENT 3.1 – A

Danh mục: Công nghệ - Môi trường

... 73 30,5 12 B10 10 6 91 13 B 11 110 ,5 49,5 14 C1 70,5 23 5,5 15 C2 61 30 ,5 16 C3 16 76 22 ,5 17 C4 69,5 27 ,5 32 ,5 18 C5 57,5 22 31 ,5 19 C6 77,5 51, 5 10 ,5 20 C7 78 51, 5 10 ,5 21 C8 80,5 24 ,5 7,5 K1 ... K9 Office 2 91 106 ,2 K10 P.T.Dục 22 0,7 12 8,7 K 11 K.N.Hàng 1 22 0,7 12 8,7 K 12 K.N.Hàng 2 91 106 ,2 K 13 Coffee 1 2 73 14 0 K14 P.M.Tính 60 0 K15 Sảnh 1- T.Tân 33 8,5 35 2, 8 K16 Sảnh 14 1 ,2 90 K17 Coffee 28 8,6 ... 0 ,20 2 15 ,38 0 ,16 7 12 5,4 70/45 Shop,Retail 21 70 0 ,25 4 1, 5 0 ,16 7 12 5,4 75/70 P.T.Dục 21 70 0,845 6,97 0 ,16 7 11 5,4 11 7/ 13 3 P.Máy tính 21 70 0,5 53 12 0 ,16 7 12 21 4 87/ 63 K.Thương Mại 21 70 0 ,20 2...

10
1,359
3

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

Danh mục: Báo cáo khoa học

... 11 , 26 51 26 65 Taylor NA, Van De Ven WJ & Creemers JW (20 03) Curbing activation: proprotein convertases in homeostasis and pathology FASEB J 17 , 12 15 12 27 Fricker LD, McKinzie AA, Sun J, Curran ... (19 96) Activation of human liver alpha-hydroxysteroid dehydrogenase by sulphobromophthalein Biochem J 31 3, 17 9– 18 4 31 Noriega GO, Juknat AA & Batlle AM (19 92) Non-essential activation of rat liver ... conformational change and oligomerization of hepatitis B virus capsid protein Biochemistry 43, 9989–9998 34 90 30 Matsuura K, Tamada Y, Deyashiki Y, Miyabe Y, Nakanishi M, Ohya I & Hara A (19 96) Activation...

10
305
0

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Danh mục: Báo cáo khoa học

... site-containing primer Mutation Oligonucleotide sequence (5¢ )3 ) C7 3A I9 7A- R9 8A W10 1A F 116 A- L 117 A- L 118 A- G 119 A W16 2A C16 7A D17 7A- D17 9A- F18 1A P 23 3 A- P 23 4 A C 23 6 A E26 4A C27 1A C29 5A W 315 A C 32 6A AAATGAGCCCAACAAAGCCGAGAAAAACATT ... GlcNAcb-pNP and GalNAcb-pNP UDP-Gal UDP-GlcNAc UDP-GalNAc GlcNAcb-pNP Sf9mock b3GalT-I C7 3A I9 7A- R9 8A W1 01 F 116 A- L 117 A- L 118 A- G 119 A W16 2A C16 7A D17 7A- D17 9A P 23 3 A- P 23 4 A C 23 6 A E26 4A C27 1A C29 5A W 315 A ... 16 6 13 1 75 16 0 80 26 5 76 13 3 16 6 88 76 11 5 10 1 93 99 82 11 2 77 12 14 23 13 40 73 15 26 40 33 88 22 65 93 12 72 13 5 14 8 12 9 64 54 76 12 5 12 9 60 66 14 6 67 14 1 13 4 66 12 9 23 8 M Malissard et al (Eur...

7
404
0

Module 1 C++ FundamentalsTable of ContentsCRITICAL SKILL 1.1: A Brief History of C++ pps

Danh mục: Cơ sở dữ liệu

... the variable A variable is a named memory location that can be assigned a value Further, the value of a variable can be changed during the execution of a program That is, the content of a variable ... in a statement, it is automatically called so that its return value can be obtained To review: an argument is a value passed into a function A return value is data that is passed back to the calling ... C++ standardization process Several years ago, work began on a standard for C++ Toward that end, a joint ANSI (American National Standards Institute) and ISO (International Standards Organization)...

41
285
0

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Danh mục: Báo cáo khoa học

... PNP 1 12 24 62 13 15 37 19 12 14 12 42 20 12 21 33 18 12 15 42 21 11 19 11 43 17 11 12 34 24 19 18 16 48 17 67 16 7 16 7 667 667 667 833 5000 PNPG5 Wild-type M53E M5 3A M53S M53G M53D M53Y M53Wa G ... 68 83 7489 718 6 68 83 50 72 9 01 13 69 92 9 611 9 11 1 13 5 20 2 21 7 4866 7895 7895 8 12 830 25 528 5 8 410 9 8 410 1 6896 19 5 21 4 477494 20 0 21 7 19 62 13 5775 55 73 638 1 23 6 2 53 416 0 25 728 6 11 814 4 4867 711 736 905 9 31 11 0 41 13 4 ... Y51AMY2 and Y82TAA are in orange Other binding residues (W9AMY2, H92AMY2, T94AMY2, A9 5AMY2, Y 13 0 AMY2, A1 45AMY2, F180AMY2, K182AMY2, W206AMY2, S208AMY2, Y 21 1 AMY2, H288AMY2, Q294AMY2, M296AMY2 and...

14
557
0

P.7 UNIT 2 LOP 7 ( A 1 A 2 A 3)

Danh mục: Tiếng anh

... 936 35 1 7 93 23 7 0 41 8 21 6 52 VI PRODUCTION : * SURVEY No NAME ADDRESS TELEPHONE NUMBER H NHAT 25 Ton Dan street 21 1 799  Learn by heart new words and the form  Ask and answer about the phone ... between Hoa and Lan HOA LAN HOA LAN 26 2 019 Thanks I’ll call you soon Yes , Lan ? Excuse me, Hoa What’s your telephone number ? III Model sentences : What’s your telephone number ? 26 2 019 NOTES ... 27 5 564 NGUYỄN VĂN BẢO 5 21 936 W hat is A n’ s tel ephone nu mber ? S even three fou five six one oh r V LISTEN : • Listen and write the telephone numbers : 2 51 654 25 0 514 5 21 936 35 1 7 93 23 7 ...

13
5,012
7

Lets go 1 A(FOR GRADE 3).ppt

Danh mục: Tư liệu khác

... Weather report It’s sunny It’s cloudy rainny It’s ...

23
874
15

Unit 8 Out and About A 1 -A 3

Danh mục: Tiếng anh

... What are they doing? They are ing… What are you doing? I am ing… What is he doing? He is driving his car Thur.Dec 2nd, 2 010 Lesson 1: What are you doing? (A1 -3) Team A Team B start 10 What are ... S + am / is / are Note: play Ride/ Drive/ have + V _ing playing Riding/ Driving/ having Thur.Dec 2nd, 2 010 Lesson 1: What are you doing? (A1 -3) Listen and repeat 1 Listen and read I am playing ... Match mean of transportation with the correct word a b c d motorbike car train bus e f bike plane walking g Thursday, December, 2nd, 2 010 Lesson 1: What are you doing? (A1 -3) Drive (v)...

46
477
0

Lab 3.1.5 Configuring a Serial Interface

Danh mục: Quản trị mạng

... Verify that the serial connection is functioning a ping the serial interface of the other router BHM#ping 19 2 .16 8 .15 .1 GAD#ping 19 2 .16 8 .15 .2 b From GAD, ping the BHM router serial interface Does ... to Interface Summary GAD(config)#interface serial GAD(config-if)#ip address 19 2 .16 8 .15 .1 25 5 .25 5 .25 5.0 GAD(config-if)#clock rate 56000 GAD(config-if)#no shutdown GAD(config-if)#exit GAD(config)#exit ... #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0) FastEthernet (FA1) Serial (S0) Serial (S1)...

5
341
0

Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

Danh mục: Quản trị mạng

... (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 25 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 26 00 FastEthernet 0/0 FastEthernet 0 /1 (FA0 /1) Serial 0/0 (S0/0) Serial 0 /1 (FA0/0) (S0 /1) ... completion of the previous steps, logoff by typing exit Turn the router off Remove and store the cables and adapter 3- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 1. 5 Copyright  20 03, Cisco ... Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0)...

5
535
0

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

Danh mục: Quản trị mạng

... Verify that the serial connection is functioning by pinging the serial interface of the other router London#ping 19 2 .16 8 .15 .2 Paris#ping 19 2 .16 8 .15 .1 a From London, can you ping the Paris router’s ... interface serial 2- 6 CCNA 4: WAN Technologies v 3. 0 - Lab 3. 1. 7 Copyright  20 03, Cisco Systems, Inc This will show the details of interface serial Answer the following questions: a Serial is ... the router off • 4-6 Logoff by typing exit Remove and store the cables and adapter CCNA 4: WAN Technologies v 3. 0 - Lab 3. 1. 7 Copyright  20 03, Cisco Systems, Inc Erasing and reloading the router...

6
368
0

Trờng THPT Quế Võ số 1 -Kỳ thi: Thử Đại học lần 3 - Khối A - Lớp 12 - 201

Danh mục: Hóa học

... gam 23 , 4 gam B 9 ,2 gam 13 , 8 gam C 9 ,2 gam 22 ,6 gam D 23 , 4 gam 13 , 8 gam Câu 39 : Ôxi h a lượng Fe thành hỗn hợp X gồm FeO , Fe3O4 , Fe2O3 cần a mol O2 Khử hoàn toàn hỗn hợp X thành Fe cần b mol Al ... lượng 1, 6 gam có tỷ khối hydro 20 CTĐGN X A C2H6O5N2 B C3H10O3N2 C C4H10O5N2 D C3H8O5N2 Câu 46: H a tan a gam oleum H2SO4.3SO3 vào 10 0 gam dung dịch H2SO4 10 % thu oleum có phần trăm khối lượng SO3 ... thành 2, 4,6-tribrom clorua toluen.; Những câu là: A 1, 2, 3, B 1, 3, C 1, 2, 3, 4, D 1, 2, Câu 15 : Cho phản ứng: (1) O3 + dung dịch KI ; (2) F2 + H2O ; (3) MnO2 + HCl (to) ; (4) Cl2 + dung dịch H2S...

4
319
2

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx

Danh mục: Quản trị mạng

... important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2- 2 CCNA 1: Networking Basics v 3. 0 - Lab 3. 1. 1 Copyright  20 03, ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...

2
392
0

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc

Danh mục: Quản trị mạng

... important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2- 2 CCNA 1: Networking Basics v 3. 0 - Lab 3. 1. 1 Copyright  20 03, ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...

2
374
0

Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

Danh mục: Quản trị mạng

... (FA0) FastEthernet (FA1) Serial (S0) Serial (S1) 25 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 26 00 FastEthernet 0/0 FastEthernet 0 /1 (FA0 /1) Serial 0/0 (S0/0) Serial 0 /1 (FA0/0) (S0 /1) ... completion of the previous steps, logoff by typing exit Turn the router off Remove and store the cables and adapter 3- 5 CCNA 2: Routers and Routing Basics v 3. 0 - Lab 3. 1. 5 Copyright  20 03, Cisco ... Serial Interface Model Interface #1 Interface #2 Interface #1 Interface #2 #5 800 (806) Ethernet (E0) Ethernet (E1) 16 00 Ethernet (E0) Ethernet (E1) Serial (S0) Serial (S1) 17 00 FastEthernet (FA0)...

5
431
0

Tài liệu ADC’s HDSL Interface Panel combines HDSL termination, DSX-1 and DSX-3 into a single shelf doc

Danh mục: Phần cứng

... ACE -20 0 ACE-400 Size (HxWxD) 35 x16x14 39 x24x16 51x30x 22 53x55x 23 Serving Area Size 32 -14 4 homes 32 - 21 6 homes 32 -576 homes 32 -11 52 homes Mounting Aerial or ground Aerial or ground Ground only Ground ... 1x16 1x 32 Specifications not include 2dB connector loss Web Site: www.adc.com From North America, Call Toll Free: 1- 800 -36 6 -38 91 • Outside of North America: +1- 9 52- 938 -8080 Fax: +1- 9 52- 917 - 32 37 ... only Splitter Configurations Standard Splitters 1x4 1x8 1x16 1x 32 Max loss 7.3dB 10 .70dB 14 .00dB 17 .40dB Typ loss 6.2dB 9.80dB 13 . 20 dB 16 .50dB Uniformity 1. 40dB 1. 00dB 1. 50dB 2. 00dB Return Loss...

4
242
0

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

Danh mục: Quản trị mạng

... Verify that the serial connection is functioning by pinging the serial interface of the other router London#ping 19 2 .16 8 .15 .2 Paris#ping 19 2 .16 8 .15 .1 a From London, can you ping the Paris router’s ... interface serial 2- 6 CCNA 4: WAN Technologies v 3. 0 - Lab 3. 1. 7 Copyright  20 03, Cisco Systems, Inc This will show the details of interface serial Answer the following questions: a Serial is ... the router off • 4-6 Logoff by typing exit Remove and store the cables and adapter CCNA 4: WAN Technologies v 3. 0 - Lab 3. 1. 7 Copyright  20 03, Cisco Systems, Inc Erasing and reloading the router...

6
323
0

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modiﬁes the expression level of a limited number of proteins in Escherichia coli doc

Danh mục: Báo cáo khoa học

... Q8XEG2c Q8FBT4 P1 716 9 Q0TKK5 P 0A 915 P0AFG6 16 )1. 66 )2. 50 57 33 )1. 50 )2. 00 17 33 )1. 60 )2. 22 11 10 29 50 30 +3. 08 )1. 50 )2. 08 +2. 51 +2. 07 )1. 92 a The MASCOT score represents the probability that ... succinyltransferase component of 2- oxoglutarate dehydrogenase complex Scorea No of matching peptides Sequence coverage (%) 17 2 17 70 72 12 4.76 ⁄ 39 .33 5.56 ⁄ 67. 13 6 13 5 1 23 13 17 5.56 ⁄ 67. 13 6 12 5 ... 41, 11 9 21 11 930 23 Mangoni ML & Shai Y (20 09) Temporins and their synergism against Gram-negative bacteria and in lipopolysaccharide detoxiﬁcation Biochim Biophys Acta 17 88, 16 10 16 19 24 Maisetta...

18
494
0

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Danh mục: Báo cáo khoa học

... (M )1 s )1) SE (Kon) Koff (s )1) SE (Koff) KD (M) 7.00 · 10 4 4. 93 · 10 5 6 .35 · 10 5 1. 7 · 1 03 3.9 · 1 03 8 .3 · 1 03 1. 28 · 10 )2 8 .25 · 10 )3 6. 63 · 10 )4 1. 2 · 10 )4 9.0 · 10 )5 1 .3 · 10 )5 1. 83 · 10 )7 1. 68 ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC...

11
679
0