... practical purposes, we can not claim that our algorithm is capable of finding all the fine grained distinctions that are listed in manually created dictionaries such as the Longman Dictionary ... isthe automatic discovery of the possible senses of a word. A related problemis word sense disambiguation: Here the senses are assumed to be known and the task isto choose the correct one ... That is, our computations are based onthe concordance of a word. Also, we do not consider a term/term but a term/context matrix. This means, for each word that we want to analyze we get an...
... adding one to each value in the matrix.2 As usual, the one is added for smoothing purposes and to avoid problems with zero values. We de-cided not to use a sophisticated association meas-ure ... salient. Also, widely and rural are well within the adjective cluster. The comparison of the two dendrograms indicates that the SVD was capable of making ap-propriate generalizations. Also, when ... errors have a strong negative effect onthe results of the vector comparisons. Fortunately, theproblem of data sparseness can be minimized by reducing the dimensionality of the matrix. An appropriate...
... tennis tournaments and players: The application creates tournaments and players in the database and handles player registration for tournaments. The application will automati-cally place players ... com.apress.springbook.chapter01.DefaultTournamentMatchManager;public class SwingApplication {private DefaultTournamentMatchManager tournamentMatchManager;public SwingApplication(DefaultTournamentMatchManager tournamentMatchManager) {this.tournamentMatchManager ... JdbcMatchDao();matchDao.setDataSource(dataSource);DefaultTournamentMatchManager tournamentMatchManager =new DefaultTournamentMatchManager();tournamentMatchManager.setMatchDao(matchDao);new SwingApplication(tournamentMatchManager);}} The class shown in Listing...
... treatment) is failure to thrive, malabsorption and persistent diarrhoea. Other symptoms include depression, abdominal pain, anaemia, arthritis, delayed puberty, problems with dental enamel, problems ... This was based upon the protocol by Mitrofan, Paul and Spencer (2008) and adapted for this review, including the introduction of a numerical numbering system to aid data analysis. As such, a ... Paspalaki, Katakis, & Evangeliou, 2003). The risk of cancer decreases tothe same as a person without CD after a GFD has been followed for 3 to 5 years (Coeliac UK, 2007). In addition...
... [c-32P]-ATP. MBP was used as an artifi-cial substrate to assess the kinase activity and GST alone wasused as a negative control. The top panel shows the kinase assayvisualized by autoradiography and ... 5-GACGAGATTATCAGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAGAGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATGAGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3.AcknowledgementThis project was supported by grants from the Aus-trian Science ... RA, Delaney TP, Uknes SJ, Ward ER, RyalsJA & Dangl JL (1994) Arabidopsis mutants simulatingdisease resistance response. Cell 77, 565–577.26 Takahashi A, Agrawal GK, Yamazaki M, Onosato...
... of risk may not only fail adequately to warn of rising risk, but may convey the message that risk is low and falling at the precise time when systemic risk is high and rising.According to VAR ... clearanalysis of the causes of the crisis. This chapter presents that analysis in four sections: ã The global story: macro-imbalances meet financial innovation. ã The UK specific story: rapid ... policymakers can reasonably concludethat market prices have become irrational.16Given this theory and evidence, a reasonable judgement is that policymakers have to recognise thatall liquid traded...
... identifications in complex mixtures, a dramatic advantage of the top-down approach is that a final separation stage can be done in the FT MS instrument. For example, after rough separa-tion of the ... identification and character-ization of proteins comes from the masses of theirdissociation products. The solution- phase enzymaticdissociation used for the bottom-up approach is farmore generally ... solution are solvated out into the aqueous phase, while in the gas phase they are insteadsolvated onto the protein backbone, with this appar-ently favored if the backbone is in an a- helical struc-ture...
... nucleolin,together with the inevitable partial degradation ofnucleolin, mean that calculations of binding affinityare unrealistic at this stage.Nucleolin localization in muscle is analogous to PTPr ligand ... anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silverstain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2). A protein band of approximately ... contact,synaptogenesis and plasticity [14,15]. The type IIa sub-family exemplifies these neural RPTPs. These enzymeshave two cytoplasmic phosphatase domains and anextracellular region consisting...
... whether biobased approaches are going to scale. Emptage said that scaling in fermentation is straightforward, and that tanks can be scaled almost as large as sugar and fermentative organisms. ... Regalbuto, director of the Catalysis and Biocatalysis Program at NSF, said that the conversion of biomass to hydrocarbons is poorly funded. Charles Dismukes of Princeton University said that ... means they gather about twice as many of the available photons, they are prob-ably more efficient at water oxidation than photosynthesis.Moore highlighted several projects at Arizona State Uni-versity...
... so as to reach the main conclusions as simply and easily as possible. The paper is (a contrario) critical of attempts to deploy open economy models which only analyse the operations of a single ... in either country. All parameters in these arrays are constrained according to Tobinesque principles so that the sum of constants is equal to one and the sum of each of the other columns is zero. ... by generating fiscal and trade imbalances. The changing exchange rate eventually restores a steady state. As Chart 4 shows, and as is clearly implied by equations 25) and 26), the share of $...
... that:financial information is reliable, so that managers and the Board can depend on ãaccurate information to make decisions,assets and records of the organisation are not stolen, misused ãor accidentally ... an understanding of common practice in financial management, and help you to build the basic systems and practices needed in a healthy organisation. The financial situation of an organisation ... an agreement, an honoraria agreement is reached between the organisation and the consultant. It stipulates the following:honorarium payable to consultantãaddress of consultantãprofession...
... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... omcB–mutant. MR-1R was used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right of the agarose gels. (B) Visualization and separation ofhigh...
... which the skulls and hair are attached as a trophy. The bow, arrows, assagai, and clubs of the deceased are hung onthe same post. Large stones are pressed into the soil above and around the grave, ... This contribution to science was secured by Captain Henning, an agent of the company who has long resided at Ounalaska. In his transactions with the Indians he learned that traditionamong the ... traditionamong the Aleuts assigned Kagamale, the island in question, as the last resting-place of a great chief, knownas Karkhayahouchak. Last year the captain was in the neighborhood of Kagamale in quest...