diet induced epigenetic changes and cancer prevention a mantra for healthy living
Báo cáo y học: " Green tea (Camellia sinensis) and cancer prevention: a systematic review of randomized trials and epidemiological studies" ppt
... Green-tea consumption and risk of stomach cancer: a population-based case-control study in Shanghai, China Cancer Causes Control 1995, 6:532-538 Tajima K, Tominaga S: Dietary habits and gastro-intestinal ... TJ, Sharp GB, Appleby PN, Beral V, Goodman MT, Soda M, Mabuchi K: Soya foods and breast cancer risk: a prospective study in Hiroshima and Nagasaki, Japan Br J Cancer 1999, 81:1248-1256 Nakachi ... Yoshimura T, JACC Study Group: A prospective study of green tea consumption and oral cancer incidence in Japan Ann Epidemiol 2007, 17:821-826 Hara N, Sakata K, Nagai M, Fujita Y, Hashimoto T, Yanagawa...
- 7
- 296
- 0
Tài liệu Pesticide Residues in Food and Cancer Risk: A Critical Analysis pdf
... 11, 144146 American Cancer Society (2000) Cancer Facts and Figures2000. American Cancer Society, Atlanta American Medical Association (AMA) Division of Drugs (1983) AMA Drug Evaluations, 5th ... aatoxin B1 : A modeling approach Risk Anal 12, 559567 Yamagami, T., Handa, H., Juji, T., Munemitsu, H., Aoki, M., and Kato, Y (1983) Rat pituitary adenoma and hyperplasia induced by caffeine administration ... that species from the Carcinogenic Potency Database Average TD50 values, have been calculated separately for rats and mice, and the more potent value is used for calculating possible hazard a...
- 45
- 591
- 0
Air pollution from traffic and cancer incidence: a Danish cohort study potx
... criteria air pollutants and risk of death from bladder cancer in Taiwan Inhal Toxicol 2009, 21:48-54 Castano-Vinyals G, Cantor KP, Malats N, Tardon A, Garcia-Closas R, Serra C, Carrato A, Rothman ... smoking-related cancers, such as esophagus and bladder cancer, and Page of 11 breast cancer, whereas the IRR for e.g cervical cancer was less strongly affected by adjustment Figure shows adjusted ... particular the hypotheses of associations with brain and cervical cancer require further testing Additional material Additional file 1: Occupations and jobs associated with risks for each cancer...
- 11
- 560
- 0
Cell Biology and Cancer under a contract from the National Institutes of Health doc
... understanding of Correlation to Cell Biology and Cancer • personal and community health Activities 1, 4, and • natural and human -induced hazards Activities 1, 4, and 23 Ä Cell Biology and Cancer ... bio logical basis (Cancer and the Cell Cycle and Cancer as a Multistep Process), to a discussion of how people evaluate claims about cancer (Evaluating Claims About Cancer) , to a consideration of ... specialists are having in the war against cancer came in the 1998 announcement by the National Cancer Institute, the American Cancer Society, and the Centers for Disease Control and Prevention that cancer...
- 164
- 578
- 0
Báo cáo y học: " Systems-level comparison of host responses induced by pandemic and seasonal influenza A H1N1 viruses in primary human type I-like alveolar epithelial cells in vitro" pdf
... 3000 7G (Affymetrix) GeneSpring GX 11 (Agilent) was used for the normalization, filtering and statistical data analysis of the Affymetrix microarray data The linear data was first summarized using ... for further GO and pathway analysis GO and pathway over-representation analysis as well as further analysis of protein-protein interactions and transcription factor regulation were carried out using ... Multichip Average (RMA) summarization algorithm on the CORE probesets and Baseline Transformation to Median of all samples for three major tasks including Background Correction, Normalization and Probe...
- 9
- 359
- 0
Báo cáo y học: " Role of pulmonary intravascular macrophages in endotoxin-induced lung inflammation and mortality in a rat model" pot
... containing 0.05%Tween-20) Standards and samples (100:l; diluted in PBST containing 1% BSA) were added to the wells and plate was incubated at 37°C for hours After removing standards and samples, ... by comparing LPS -induced lung inflammation and mortality in BDL rats and GCtreated BDL rats The dramatic finding was 100% and 80% survival in BDL rats that were treated with GC 48 hours and hours, ... conjugated secondary antibodies for one hour The sections were stained with 2% aqueous uranyal acetate and then lead citrate Reverse transcriptase-polymerase chain reaction Total RNA was extracted from...
- 11
- 373
- 0
Báo cáo y học: "Morphological instability and cancer invasion: a ''''splashing water drop'''' analogy" potx
... 24 Hanahan D, Weinberg RA: The hallmarks of cancer Cell 2000, 100:57-70 Nakano A, Tani E, Miyazaki K, Yamamoto Y, Furuyama J: Matrix metalloproteinases and tissue inhibitors of metalloproteinases ... shows that (i) surface tension in the multicell aggregates they have used is independent of the compressive forces and that the spheres practically behave as a liquid and not as elastic aggregates; ... that we propose an analogy with the case of a liquid drop, which impacts on a solid surface and causes the formation of a fluid 'crown' Such instability, termed Rayleigh or Yarin-Weiss capillary...
- 6
- 250
- 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf
... Liljas A, Kristensen O, Laurberg M, Al-Karadaghi S, Gudkov A, Martemyanov K, Hughes D & Nagaev I (2000) The states, conformational dynamics, and fusidic acid-resistant mutants of elongation factor ... structures demonstrate large conformational changes in the eukaryotic ribosomal translocase Nat Struct Biol 10, 379–385 Al Karadaghi S, Aevarsson A, Garber M, Zheltonosova J & Liljas A (1996) The structure ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain...
- 15
- 474
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢)...
- 14
- 473
- 0
E-Commerce and Consumer Goods A Strategy for Omnichannel Success doc
... marketing, and specializes in strategy and capability development for consumer brand marketers, marketing services firms, and media companies Arun Rajagopalan is a principal with Booz & Company based ... Offices Asia Beijing Delhi Hong Kong Mumbai Seoul Shanghai Taipei Tokyo Australia, New Zealand & Southeast Asia Bangkok Brisbane Canberra Jakarta Kuala Lumpur Melbourne Sydney Europe Amsterdam Berlin ... purchases, and descriptive materials and images that make it easier for consumers to find and learn about the manufacturer’s products on the retailer’s website; capturing, and mining online sales...
- 16
- 266
- 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx
... PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled reaction products and radioactive standards were quantitated using IMAGEQUANT software (Amersham ... Schizophrenia and Depression (JAB), the National Institute of Mental Health (ACN and RWG), the Department of Defense (JAB and AAF), the Department of Veterans A airs (RWG), and the Ella McFadden Charitable ... 20 amino acids of mAK-L (MAAADEPKPKKLKVEAPQA) are replaced by four residues (MTST) in mAK-S This results in a length of 361 and 345 amino acids for mAK-L and mAK-S, respectively Mouse and human...
- 9
- 497
- 0
Excess Cervical Cancer Mortality: A Marker for Low Access to Health Care in Poor Communities doc
... mortality from breast cancer (Maps and 10) and colorectal cancer (Maps and 9) as well as heart disease (Maps and 11) and cerebrovascular disease (Maps 12 and 15), and there is high infant mortality ... little data was available and less is known about the causes of cervical cancer mortality disparities among Native Americans in the Northern Plains and among Alaska Natives, it was also acknowledged ... evidence-based cancer control programs, targeted efforts would be needed to make state and local health administrative and provider organizations, voluntary and advocacy organizations, and the private...
- 96
- 283
- 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx
... Iizumi Y, Sagara H, Kabe Y, Azuma M, Kume K, Ogawa M, Nagai T, Gillespie PG, Sasakawa C & Handa H (2007) The enteropathogenic E coli effector EspB facillitates microvillus effacing and antiphagocytosis ... actin filaments that accumulate at pedestals formed underneath the attachment site of bacterial cell 2410 cell (Fig 1) that serves as a conduit between bacterial and host-cell membranes Pore formation ... 2403–2408 Hamaguchi M, Hamada D, Suzuki KN, Sakata I & Yanagihara I (2008) Molecular basis of actin reorganization promoted by binding of enterohaemorrhagic Escherichia coli EspB to a- catenin FEBS...
- 7
- 333
- 0
báo cáo hóa học:" Research Article Design and Implementation of a Testbed for IEEE 802.15.4 (Zigbee) Performance Measurements" doc
... (PAN) for patient monitoring Fort et al in [9] create a model to understand radio narrow band propagation near the body at the 915 MHz and 2.45 GHz bands A model is developed for path loss, small-scale ... created for each trial A second Java program (Analyze.java) was developed to analyze the saved files containing the received packets Since the transmitted data is known, this program can easily calculate ... for that particular packet All of these packets are picked up by BaseStation.java listening on the USB port and it saves each consecutive packet in a file for future analysis A new file is created...
- 11
- 521
- 0
báo cáo khoa học: " Translating research into practice in Leeds and Bradford (TRiPLaB): a protocol for a programme of research" ppsx
... Airedale, stakeholder consultation in the area of child and maternal health care with a range of commissioners and practitioners revealed the importance of maternal mental health as a focus for activity ... [11,20] The data will be analysed using a framework approach [21]: familiarisation with the data, identification of a thematic framework, indexing, charting, and finally, mapping and interpretation ... organisation) to translate research-based findings into practice in the areas of maternal mental health and stroke care, and with Leeds Partnership Foundation Trust (a provider of mental health...
- 6
- 230
- 0
báo cáo khoa học: " Bridging the gap between basic science and clinical practice: a role for community clinicians" pptx
... Newberry for editorial assistance and Nancee Inouye for research assistance associated with the project Author details RAND Health, Santa Monica, California, USA 2Department of Medicine, David Geffen ... explanatory and participatory (or practical) research trials Combining explanatory and participatory trials may be an effective strategy for including community practice settings in research that ... quantitative and qualitative value of their participation in studies A clinical trial registry would also provide a venue for sharing trial data among participants of ongoing trials, potentially...
- 11
- 460
- 0
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... included footwear was also reported Intra-rater and inter-rater reliability for all categorical data was evaluated using percentage agreement, and kappa (κ) statistics [51,52] Kappa values above 0.80 ... Intra-rater ICCs and 95% LOAs for quantitative measures are shown in Table Similar intra-rater reliability was found for both raters across all measures Most quantitative measures demonstrated ... forefoot height, and longitudinal profile demonstrated at least substantial intra-rater reliability and at least moderate inter-rater reliability for all measures The percentage agreement statistic...
- 12
- 379
- 0
Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc
... 5’-CCGGTGACAAAGCAGGTAGAG-3’ and reverse 5’-GTGAACTTGCAGAGGTTCGTGTA-3’ pair of primers, whereas the use of the HPRT1 forward 5’TGGAAAGGGTGTTTATTCCTCAT-3’ and reverse 5’-ATGTAATCCAGCAGGTCAGCAA-3’ primers ... expression and the ER status revealed a strong negative correlation in the breast cancer Table Associations between KLK5 status and the clinicopathological variables of the breast cancer patients Variable ... expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions Margaritis Avgeris1, Georgia Papachristopoulou1,2, Athanasios Polychronis2 and Andreas Scorilas1* * Correspondence:...
- 12
- 340
- 0
Design and implementation of a testbed for indoor mimo systems
... channel In addition, w e only pay attention to uniform antenna arrays in this section, that is, all an tennas are aligned and equally separated in the tran sm it and receive antenna arrays 8 2.2.1 ... create b aseb and signal and m odulation type to be applied in the tran sm itter and to receive reco vered data signal for channel capacity co m p u tin g (figure 19) Both b aseb an d and IF parts ... illustrated as in figure 3b w hich has N transm it antenn as and only rcceive antenna If < is the difference angle betw een the j) tran sm it an ten n a array and the transm itted signal, and AtXc...
- 61
- 354
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25