did a higher power help eric clapton and mary karr stop drinking
CÁC LỢI ÍCH KHI VẬN HÀNH MÁY PHÁT Ở HỆ SỐ CÔNG SUẤT CAO (Benefits of operating your generator at a higher power factor )
Ngày tải lên :
12/08/2014, 12:51
... On-site Generation The Figure Shows How The Realand Reactive Power Flow Can be Changed For The Addition of a Capacitor Bank Generator Capability Every generator has its own capability curve and this ... today's de-regulated market place, MWATTS of power can equate to millions of dollars a year in savings Payback periods for the capacitor bank can be less than one month Figure - Typical Power System ... information should be available with the machine documentation or from the manufacturer The capability curves define the operating characteristics of the generator in terms of kW and KVar A typical...
- 3
- 607
- 3
A low power design for arithmetic and logic unit
Ngày tải lên :
16/09/2015, 14:04
... software, several programs are analyzed and reduction on power consumption is estimated Details of the development work and a summary on the program analysis and power consumption estimation are ... circuits: dynamic switching power, short circuit power and leakage current power Dynamic switching power occurs when load and parasitic capacitances in the circuit are changed or delayed as a result ... popular and widely-used over the past few years One reason for the widespread adoption is their usability such as a transformation to a graphical interface The ability for such a transformation has...
- 116
- 468
- 0
Software Design and Development (A guide) is help you how to managed IT Project. Especially for Design and Develop software project.
Ngày tải lên :
15/10/2013, 23:13
... Initiation Phase Requirement Mission analysis stage Concept Dev Stage Development Phase System analysis stage System design stage Construct & acq stage User accept stage Operation and Maintenance ... and approve the design Day - Software Design Design includes an evaluation of the adequacy of the detailed technical requirements, an evaluation of the design choices, and a verification that ... conform to standards ? Day - Software Design Reviewing the design - finally Scrutinize the list of planned activities and test activities to ascertain whether any changes or additions are needed...
- 88
- 649
- 0
A reliability data base for performance and predictive assessment of electric power systems
Ngày tải lên :
03/01/2014, 19:36
... Statistics, Canadian Electrical Asso~iation, Instruction Manual for Reporting Generation Equipment Outage Data, Canadian Electrical Association, Montreal Billinton R and Allan R N 1984 Reliability ... such a curtailment This information can be obtained from a frequency and duration analysis The additional parameters required for such an analysis are the transition rates associated with the appropriate ... the area of operating reserve assessment and probabilistic evaluation of transient stability ( ) Billinton and Chu (11) The SRIS data base can provide almost all the basic data required in a probabilistic...
- 6
- 482
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
Ngày tải lên :
19/02/2014, 05:20
... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of ... Chu GC, Katakura K, Tomita T, Zhang X, Sun D, Sato M, Sasahara M, Kayama T, Ikeda-Saito M & Yoshida T (2000) Histidine 20, the crucial proximal axial heme ligand of bacterial heme oxygenase Hmu ... gradually and was replaced by a new broad band with a maximum at approximately 675 nm, identical to the absorption band of free biliverdin The heme–GmHO-1 reaction under a CO atmosphere was also carried...
- 16
- 617
- 0
BANK OF AMERICA AND MERRILL LYNCH: HOW DID A PRIVATE DEAL TURN INTO A FEDERAL BAILOUT? potx
Ngày tải lên :
06/03/2014, 09:22
... American people demand to be answered, and I know that the chairman and the ranking member talked about that We look forward to that happening in a bipartisan fashion in the near future VerDate ... preferred shares and warrants in Bank of America That money was committed by the Treasury Department and the Federal Reserve, and Mr Lewis is here today, as the CEO of Bank of America, thanks to ... ratio being paid between the buying company and the selling company that is more at stake Had Bank of America had to pay a greater amount in the stock trade than it did, the value of Bank of America...
- 196
- 350
- 0
Đề tài " Higher composition laws I: A new view on Gauss composition, and quadratic generalizations " docx
Ngày tải lên :
14/03/2014, 22:20
... by 2 ( 2a1 − 3a0 a1 a2 + a0 a3 − ε a0 ), 2 (a1 a2 − 2a0 a2 + a0 a1 a3 − ε a1 ), − (a1 a2 − 2a2 a3 + a0 a2 a3 + ε a2 ), 2 − 3a a a + a a2 + ε a ), − ( 2a2 3 c0 = c1 = c2 = c3 = where as usual ε = ... Let S again be an oriented quadratic ring and K = S ⊗ Q the corresponding quadratic Q-algebra A rank n ideal of S is an S-submodule of K n having rank 2n as a Z-module Two rank n ideals are said ... into a single rank ideal class M On the other hand, if follows again from Bass’s theorem [1] that any rank ideal class over a quadratic ring S is a direct sum of rank ideal classes Hence the map...
- 35
- 430
- 0
Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx
Ngày tải lên :
22/03/2014, 11:20
... Thanh, Nguyen Anh Tuan, Bach Gia Duong, Research, Design And Fabrication Of The 45W And The 200W, L-Band Power Amplifier Using The Modern Microstrip Technology For Application In The National ... have also investigated the S11 factor of the power divider Wilkinson on network analyzer, the result was relatively similar to that of the simulink model Afterthat we have measured the characteristics ... of port and port But now look closer at the scattering matrix We also note that the ports and of this device are matched It looks a lot like a lossless 3dB divider, only with an additional resistor...
- 5
- 374
- 0
THE GROUP SAVINGS RESOURCE BOOK - A practical guide to help groups mobilize and manage their savings ppt
Ngày tải lên :
22/03/2014, 21:20
... in Zambia This was later expanded, with generous funding from the Netherlands in 1998 to Tanzania and Zimbabwe, and served as a major source of information for this book Additional valuable insights ... management, as has been seen in the case of the Grameen Bank experience in Bangladesh By providing a means to safely pool their savings, these approaches can help the poor and disadvantaged accumulate ... and NGOs are now advocating a more balanced approach to financing poverty alleviation efforts that places savings and other financial services in the forefront of credit Critics often say that...
- 8
- 433
- 0
Children are Everyone’s Business: A practical workbook to help companies understand and address their impact on children’s rights potx
Ngày tải lên :
23/03/2014, 02:20
... Savic and Clara Sommarin External: Desiree Abrahams, Chris Avery, Malena Bengtsson, Sara Damber, Aidan Davy, Rachel Davis, Adrienne Gardaz, Halshka Graczyk, John E Grova, Marie Guibreteau, Susan ... company and its available resources, consider reporting annually or periodically to internal and external stakeholders on results achieved, dilemmas and challenges faced, and plans, targets and ... additional preparation and consideration to make sure it is done in an appropriate way and to follow ethical standards that make it effective and meaningful for children and useful for the company...
- 120
- 363
- 0
Đề tài " Global existence and convergence for a higher order flow in conformal geometry" pptx
Ngày tải lên :
28/03/2014, 22:20
... [10] A Connes, Noncommutative Geometry, Academic Press, San Diego, CA (1994) [11] Z Djadli, A Malchiodi, and M Ahmedou, Prescribing a fourth order conformal invariant on the standard sphere – Part ... that both conditions are satisfied if Y (g0 ) ≥ and M Q0 dV0 ≥ 0, and M is not conformally equivalent to the standard sphere S C Fefferman and R Graham [14], [15] established the existence of a ... functional, de Rham cohomology, and K¨hler-Einstein metrics, a Ann of Math 148 (1998), 315–337 [17] M Gursky, The principal eigenvalue of a conformally invariant differential operator, with an application...
- 22
- 345
- 0
Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot
Ngày tải lên :
30/03/2014, 10:20
... monomeric antenna proteins (CP26, CP29 and LHCII monomers) (band 2), and tri4620 meric LHCII (band 3), monomeric (band 4) and dimeric (band 5) PSII cores Bands and contained supramolecular complexes ... and Chl b, and for total carotenoid content (Tot Car) LL, low light; HL, high light; VAZ, violaxanthin, antheraxanthin and zeaxanthin Chl b Neoxanthin Violaxanthin Antheraxanthin Lutein Zeaxanthin ... (CL) plants are shown Data are normalized to 100 Chl a molecules The maximum standard deviations determined were for neoxanthin and antheraxanthin, for violaxanthin, zeaxanthin and b-carotene,...
- 15
- 476
- 0
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
Ngày tải lên :
19/06/2014, 10:20
... fear of falling that appears to be related to this increased stride variability, and have an increased risk of falls [8,9] Further, the extrapyramidal, limbic systems, and the frontal lobe apparently ... repeated measures For each gait parameter, a separate model was applied The dependent variable was the gait parameter and the independent variables were the group (patients or controls), the walking ... effects of an attention demanding task on the gait of healthy young and older adults [35,36] When healthy young or older adults are asked to walk and perform an additional task simultaneously, gait...
- 8
- 415
- 0
báo cáo hóa học: " A prototype power assist wheelchair that provides for obstacle detection and avoidance for those with visual impairments" pptx
Ngày tải lên :
19/06/2014, 10:20
... platform for researchers, but have several disadvantages when compared with manual wheelchairs In general, manual wheelchairs are lighter and more maneuverable than power wheelchairs, and can ... and can be transported in a car Manual wheelchairs that make use of power assist hubs are heavier than traditional manual wheelchairs, and can be more difficult to disassemble for transport depending ... The sonar sensors have a maximum range of 3.05 m and a minimum range of 2.54 cm The advantages of a smaller range are that (1) the frequency of sonar readings is increased and (2) the sonar system...
- 11
- 421
- 0
Báo cáo y học: " Seeking help for depression from family and friends: A qualitative analysis of perceived advantages and disadvantages" pps
Ngày tải lên :
11/08/2014, 16:21
... Mental Health Research, The Australian National University, Acton, Canberra, ACT, Australia, 0200 Directorate of Mental Health, Department of Defence, CP2-7-04 3A, Canberra, ACT, Australia, 0200 ... person was also seen as an advantage For example, one respondent noted: “It was confidential and familiar and not cold and clinical as I would imagine the professionals are” Involving family also ... Accessibility and acceptability of help The accessibility of family and friends was seen as an advantage by many participants In contrast to professionals, family and friends were perceived as...
- 35
- 658
- 0
Báo cáo y học: "forms a higher order oligomer and enhances ATPase activity of replication initiator protein (Rep/AC1)" ppsx
Ngày tải lên :
12/08/2014, 04:20
... experiments: All_AC3_Fwd: 5'- CATGAGCTCGGATCCATGGATTCACGCACAGGG -3' All_AC3_Rev: 5'- CCATCTAGACTCGAGTGGCRTGTACTCAYGCCTCTAAYCC -3' ToLCV_AC1_Fwd: 5'- CATGGATCCATGGCHVCYCCMAAWCG -3' ToLCV_AC1_Rev: 5'- TGACTCGAGTCAACYCGWCGACGHCTGG ... forms a faint peak at 11 th fraction and a prominent peak at 32 nd fraction as indicated by 'V' Arrows indicate the peak formation of molecular weight standard proteins: Aldolase (158 kDa) at 17 ... enhances the ATPase activity of AC1 gives light on the way AC3 enhances viral DNA replication At higher concentration, AC3 failed to upregulate AC1-mediated ATPase activity indicating that AC1...
- 8
- 259
- 0
disagreeing among power-unequals in english and vietnamese a cross-cultural pragmatics study = cách diễn đạt sự bất đồng giữa những người không bình đẳng về quyền lực trong tiếng anh và tiếng việt
Ngày tải lên :
02/03/2015, 14:30
... help learners and non-native speakers of English become aware of potential similarities and differences between their language and culture and English language and culture as well as potential ... pragmatics Social Distance Discourse completion task/test Face Threatening Act Hearer Interlanguage Interlanguage pragmatics Metapragmatic assessment questionnaire Relative Power Pragmatic transfer ... Samovar and Porter (2001), and Ting-Toomey & Chung (2005), high -power- distance values are appreciated in Asian countries while lower -power- distance values are appreciated in the USA, Great Britain and...
- 295
- 825
- 1
Design and development of a CMOS power amplifier for digital applications
Ngày tải lên :
04/10/2015, 10:25
... operating at Class A, second stage is operating at Class AB and third stage is operating at Class C Last but not least, the final stage is operating as Class D amplifier The final stage transistor ... inductance value with the smallest area The spiral inductor can be of rectangular shape, octagonal shape, circular or other shapes 2.3.2 Capacitor There are a few ways to realize a capacitor in a ... the parasitic capacitance can be lumped to the main capacitance Another alternative is to use a MOS capacitor, which is actually the gate capacitance of a MOS transistor As the gate length of...
- 103
- 419
- 0
Energy, exergy and environmental analysis of a hybrid combined cooling heating and power system utilizing biomass and solar energy
Ngày tải lên :
29/07/2016, 14:01
... residual tar and char, which were simulated and validated for biomass air gasification preferably Using that biomass gasification model, wood chips as a biomass material (Table 2) are gasified ... the vapor, respectively hlv (kJ/kg) is the latent heat of vaporization, and Psat and Pa (kPa) are the pressures of the saturated vapor and ambient, respectively Tc and Lc are the temperature and ... both increase gradually at first, and then increase slowly after reaching a certain level 5.2.2 Variable solar irradiation At a 100 kW electrical output, the variable solar irradiance mainly influences...
- 12
- 428
- 0
Power Relationships Within A Corporate Finance Department: A Foucauldian Approach To Corporate Hierarchies And Resistance
Ngày tải lên :
10/12/2016, 17:14
... interpretative, radical humanist and radical structuralist These four paradigms are based on fundamental assumptions that are made about the nature of society and social science Each paradigm is founded ... measures Real life need not be as dramatic as Shakespeare’s plays, but this does not mean to say that sexual power, either by a woman or a man, can impact upon and cause different behaviours Attractiveness ... demonstrate how female sexuality and beauty are a threat to patriarchal society and must be controlled Both of these plays emphasise the power that arises from female sexuality and how this power can...
- 201
- 334
- 0