diagnostic and therapeutic advances clinical gastroenterology
Báo cáo khoa học: Alpha-fetoprotein antagonizes X-linked inhibitor of apoptosis protein anticaspase activity and disrupts XIAP–caspase interaction ppt
Ngày tải lên :
07/03/2014, 12:20
... blue and red, respectively The BIR2 and BIR3 domains are shown in green The dashed yellow lines connect the ATIF peptides of each AFP monomer and the IBM-interacting grooves of the BIR2 and BIR3 ... cell lines and tissues has shown that many tumor cell lines and tissues have constitutively higher levels of active caspase and free cytochrome c in the absence of apoptotic stimuli and yet are ... cold NaCl ⁄ Pi, and AMC liberation was measured using Victor-1420 Multilabel counter (Wallac, Finland) at excitation 355 nm and emission 460 nm All samples were analyzed in duplicate and the experiments...
- 13
- 445
- 0
Báo cáo y học: " Mild autonomic dysfunction in primary Sjögren''''s syndrome: a controlled study" pptx
Ngày tải lên :
09/08/2014, 10:23
... angiotensin receptor blockers (three and four participants), diuretics (two and three participants), calcium channel blockers (three and no participants) and hydrallazine (one and no participants) Five ... were asked to stand quickly and remain standing quietly for a period of minutes Brachial blood pressure was measured with a digital blood pressure monitor at and minutes after standing Valsalva ... Supine to standing ΔSBP The supine to standing ΔSBP was calculated as the brachial SBP minutes after standing minus the supine brachial SBP Supine to standing 30/15 ratio The supine to standing 30/15...
- 10
- 922
- 0
Báo cáo y học: " A three-year-old boy with X-linked adrenoleukodystrophy and congenital pulmonary adenomatoid malformation: a case report" doc
Ngày tải lên :
11/08/2014, 14:21
... insufficiency and CPAM The early and accurate diagnosis and treatment of patients with X-ALD and its complications can delay progressive degenerative changes and attenuate further neurologic and metabolic ... interests Authors' contributions IA treated the patient and analyzed and interpreted investigations and radiologic images including the chest films and computed tomography scans He was also a major ... had no detectable anti-adrenal antibodies and a non-reactive purified protein derivative skin test He was started on hydrocortisone and fludrocortisone and had a surgical removal of the CPAM a...
- 5
- 260
- 0
Báo cáo y học: "Recurrent pneumonia with mild hypogammaglobulinemia diagnosed as X-linked agammaglobulinemia in adults" pot
Ngày tải lên :
12/08/2014, 18:20
... The patient’s DNA gave a band when primer B was used (lane D) The patient’s mother, a carrier of the mutated gene, gave bands when both primers A and B were used (lanes N and D) Available online ... carriers, on the contrary, undergo random inactivation of the normal and mutated X chromosomes, and thus the product of the BTK gene can be detected in B cells and other hematopoietic cells This ... and lower lobes in April, and in the lower lobe of the right lung in November The chest radiograph on admission to our hospital in June 1997 demonstrates infiltration in the left lower lobe and...
- 5
- 217
- 0
Báo cáo y học: "X-linked agammaglobulinemia diagnosed late in life: case report and review of the literature." pps
Ngày tải lên :
13/08/2014, 13:22
... primarily to replace immunoglobulin and antibiotic therapy as needed, both patients continued to receive IGIV at optimal doses and have had moderate clinical improvement and reduction of infections We ... 13 -1 G>A Page of (page number not for citation purposes) Clinical and Molecular Allergy 2008, 6:5 and had IgG levels ranging between 20 and 773 mg/dL prior to initiation of treatment with IGIV ... age 10 months and then died at age from encephalitis [13] This case demonstrates the clinical variability of a XLA within a family in which typical and atypical variants exist and the need for...
- 7
- 542
- 0
Báo cáo y học: "Dosage compensation on the active X chromosome minimizes transcriptional noise of X-linked genes in mammals" pps
Ngày tải lên :
14/08/2014, 21:20
... abundance and a given standard deviation First, CV was calculated for 10,000 randomly generated data points (cell sampling) Next, we considered 100 populations of size 1,000 with the same mean and standard ... male-to-female Authors' contributions SY, XK, and LDH conceived and designed the experiments, and SY, XK, LDH, PW, WJ and LH analyzed the data SY, LDH and XK wrote the paper Microarray data processing ... noise ratio CV1/CV2 as one group (black curve after sorting and logarithmic transformation) and as random pairs (grey curve after sorting and logarithmic transformation) The number of different pairs...
- 11
- 366
- 0
Báo cáo y học: " Autonomic Dysfunction Presenting as Postural Orthostatic Tachycardia Syndrome in Patients with Multiple Sclerosis"
Ngày tải lên :
26/10/2012, 09:39
... each of these patients and close contacts were maintained between our center and the patients’ neurologist The patients’ neurological and autonomic center data (charts and/ or 63 physician letters) ... with POTS Criterion for diagnosis of POTS: The diagnosis of POTS was based on clinical history, clinical examination and a positive (POTS pattern) head up tilt test (HUTT) The HUTT criterion for ... elsewhere and were seen in our clinic for second opinions All but two patients were diagnosed with multiple sclerosis The diagnosis of MS was based on clinical history, neurological examination and...
- 6
- 478
- 0
Báo cáo khoa học: New insights into Fragile X syndrome Relating genotype to phenotype at the molecular level docx
Ngày tải lên :
30/03/2014, 15:20
... FMRP, FXR1P and FXR2P: KH, RGG, NLS and NES motifs Phylogenetic sequence analysis led to the suggestion that dFXRP is the ancestral progenitor of the vertebrate FMRP and FXR proteins, and that in ... in dark blue and semiconserved residues are colored in lighter shades of blue The domain boundaries, the conserved signature motif GxxG and a variable loop between b-strands b2 and b3 which was ... of the I304N mutation on the structure and function of FMRP is still unclear, and there have been several contradictory reports in the literature Dreyfuss and colleagues initially concluded, using...
- 7
- 498
- 0
modeling fragile x syndrome
Ngày tải lên :
29/05/2014, 17:33
... Denman Origins and Necessity of Modeling “Be fruitful and multiply, fill the earth and subdue it and have dominion over it.” The human imperative found in the biblical account of creation, and so to ... coordinates to describe flesh and blood atoms in terms of their three quantum numbers n, l, and m and begin to understand their Introduction: Reminiscing on Models and Modeling intrinsic properties ... perseveration) and in language competence (syntax, pragmatics) reviewed in Hagerman and Cronister (Bennetto and Pennington 1996) But how to model these deficits? Flies and zebrafish not speak and mice,...
- 403
- 612
- 0
Báo cáo vật lý: "ATTENUATION STUDIES ON DRY AND HYDRATED CROSS-LINKED HYDROPHILIC COPOLYMER MATERIALS AT 8.02 TO 28.43 keV USING X-RAY FLUORESCENT SOURCES" ppt
Ngày tải lên :
07/08/2014, 14:20
... A.N (1996) Hydrophilic materials as tissue substitutes for diagnostic and therapeutic modalities PhD thesis, University of Surrey, England White, D.R., Peaple, L.H.J & Crosby, T.J (1980) Measured ... materials and tissues Radiat Res., 84, 239–252 ICRU Report 44 (1989) Tissue substitutes in radiation dosimetry and measurements Bethesda, Maryland: International Commission on Radiation Units and Measurements ... 0.254 mm and window diameter was 50 mm Studies on Dry and Hydrated Cross-Linked Hydrophilic Copolymer 26 The industrial X-ray tube was used to irradiate copper, molybdenum, silver and tin targets...
- 10
- 274
- 0
Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot
Ngày tải lên :
09/08/2014, 06:22
... of interest: CD8+ T cells were defined as being TCR-αβ+, CD8+, and CD56-; NK cells as TCR-αβ- and CD56+; and NK T cells as TCR-αβ+ and CD56+ All populations were also restricted to a live cell ... patients with MAS and HLH [17] The unpaired t-test and Wilcoxon two-sample test were used to compare NK cytolytic activity and perforin/ granzyme B expression between the patient and control As ... TNF-α, interleukin-1, and interleukin-6, which have a major role in the various clinical symptoms and tissue damage Flow CD8+ cells analysis of perforin expression in NK cells and cytotoxic cytometric...
- 8
- 365
- 0
Báo cáo y học: "NPAS2 and PER2 are linked to risk factors of the metabolic syndrome" pps
Ngày tải lên :
10/08/2014, 09:20
... (HDL-C Plus and LDL-C Plus, Roche Diagnostics GmbH, Germany), and those of gamma-glutamyltransferase (GGT) and uric acid (IFCC/ECCLS and URIKAASI PAP, Konelab, Thermo Electron Oy, Finland) Page ... ACAAGGAGCCGGGTTCTG and the reporter sequences CTTGGGCATTTTCAT and TTGG GC GTTTTCAT for PER2 10870, and GCTCAGCAGCAGCCT GAA and CGAAACTGCGACTGGTCTGATT and the reporter sequences CTTGCTACAAGTATCTC and TTGCTACAGGTATCTC ... status examination and the diagnostic mental health interview, filled in the self-report of seasonal changes in mood and behavior and gave venous blood samples for DNA extraction and were screened...
- 9
- 482
- 0
Báo cáo y học: " Triple X syndrome in a patient with partial lipodystrophy discovered using a high-density oligonucleotide microarray: a case report" doc
Ngày tải lên :
11/08/2014, 14:20
... the patient and referred her to RAH for genetic analysis ML analyzed and interpreted the microarray results and drafted the manuscript All authors participated in manuscript production and approved ... Ontario MD/PhD Program, and is a Candian Institute of Health Research fellow in vascular research RAH is a Career Investigator of the Heart and Stroke Foundation of Ontario and holds the Edith Schulich ... http://jmedicalcasereports.com/jmedicalcasereports/article/view/8867 metabolism pathways and model organisms, and positional candidate genes, identified through linkage analysis, have uncovered mutations...
- 5
- 348
- 0
Báo cáo y học: "Chemical pneumonitis and subsequent reactive airways dysfunction syndrome after a single exposure to a household product: a case report" pptx
Ngày tải lên :
11/08/2014, 17:21
... the seven diagnostic criteria for RADS [6] The patient was started on inhaled fluticasone and salmeterol His cough and shortness of breath in response to strong odours, fumes, cold air and exertion ... air demonstrated a PO2 of 32.7 mmHg and oxygen saturation of 67.2%, which improved to 85.2 mmHg and 97.4%, respectively, with 100% inspired oxygen A chest X-ray and computer tomography of the patient ... symptoms before the product was recalled and 13 required medical treatment (Office of Information and Public Affairs CPSC, Tile Perfect, Inc.: Announce Recall of Stand N' Seal Grout Sealer Due to Respiratory...
- 6
- 335
- 0
Báo cáo y học: "Rapidly progressive Bronchiolitis Obliterans Organising Pneumonia presenting with pneumothorax, persistent air leak, acute respiratory distress syndrome and multi-organ dysfunction: a case report" pdf
Ngày tải lên :
11/08/2014, 23:21
... returned and repeat chest radiograph showed right middle and lower lobe consolidation associated with recurrent hydro-pneumothorax A new intercostal drain was inserted and he was intubated and ventilated ... association with patchy pulmonary haemorrhage and alveolar exudate He was commenced on corticosteroids (Prednisolone 1.5 mg/kg) with improvement clinically and radiologically within 72 hours This was ... [8] and CT guided percutaneous approaches have a poor yield due to the patchy distribution of BOOP and small sample size The differential diagnosis includes Acute Interstitial Pneumonitis and...
- 3
- 185
- 0
Báo cáo y học: "Close relationship of tissue plasminogen activator–plasminogen activator inhibitor-1 complex with multiple organ dysfunction syndrome investigated by means of the artificial pancreas" doc
Ngày tải lên :
12/08/2014, 18:20
... thrombin–antithrombin III complex (TAT), protein C antigen and activity, protein S antigen and activity, plasminogen, antithrombin III (AT-III), PAI-1 antigen and activity, and tissue plasminogen activator (tPA)–PAI-1 ... significant correlations between the GT and MODS, coagulopathy There were no significant correlations between the M value and MODS, and parameters related to coagulation and fibrinolysis (Table 6) Significant ... failure score and parameters related to coagulation and fibrinolysis Correlation coefficients (r) between modified multiple organ failure (mMOF) score* and parameters related to coagulation and fibrinolysis...
- 12
- 204
- 0
Báo cáo khoa học: "Cutaneous vascular reactivity and flow motion response to vasopressin in advanced vasodilatory shock and severe postoperative multiple organ dysfunction syndrome" pot
Ngày tải lên :
12/08/2014, 23:22
... transport and consumption variables, norepinephrine and milrinone requirements, as well as pH and arterial lactate concentrations were documented immediately before and hour after randomization ... mechanically ventilated and received analgesic and sedative drugs (for instance, continuous infusion of sufentanil and midazolam) There was no difference in the dosage of analgesic and sedative drugs ... decrease in small vessel numbers and, ultimately, a complete standstill in sublingual capillary flow occurred In their patient, Boerma and colleagues [25] further observed clinically evident hypoperfusion...
- 7
- 228
- 0
Báo cáo y học: "Argatroban therapy for heparin-induced thrombocytopenia in ICU patients with multiple organ dysfunction syndrome: a retrospective study" pps
Ngày tải lên :
13/08/2014, 20:22
... danaparoid and the direct thrombin inhibitors, lepirudin and argatroban Argatroban is a synthetic direct thrombin inhibitor, derived from L-arginine, that selectively and reversibly inhibits free and ... contributions BS, VP, and GM contributed to the conception and design of the study They were responsible for acquisition, analysis, and interpretation of data BS drafted the manuscript RMS and WH participated ... should be based on clinical considerations and treatment should not be delayed, pending laboratory confirmation [3,7] On suspicion of HIT, all sources of heparin should be eliminated and an alternative...
- 7
- 349
- 0