diagnosis of gastroesophageal reflux ultrasonographic method lucio villegas menendez m arguelles martin f coronel rodriguez c gonzalez fernandez f gonzalez prada f ann esp pediatr 1993 nov 39 5 4 4
Diagnosis and treatment of gastroesophageal reflux disease 2016
... recognition of atypical symptoms defining GERD, particularly when these atypical symptoms occur in the absence of typical symptoms or endoscopic evidence of mucosal damage Given the diagnostic challenges ... predictor of treatment outcome following reflux therapy [58 ] Number of Reflux Events The total numbers of reflux events on ambulatory reflux monitoring have been proposed as a means of defining ... through-thescope pneumatic dilator The goal of dilation is to provide mechanical disruption of fibrosis (Fig.2.2b) Clinical axiom suggests that achieving a luminal diameter of 141 5mm is typically sufficient...
- 165
- 2,007
- 6
báo cáo hóa học: "Impact of gastroesophageal reflux disease on patients'''' daily lives: a European observational study in the primary care setting" doc
... 2 95 (59 .6) 58 .6 ( 14 .5) 79.0 ( 15. 8) 2 65 (52 .5) 52 .5 ( 14. 3) 78 .4 ( 14 .5) 303 (57 .71) 57 .2 ( 15. 2) 78.9 (16 .4) 280 (58 .7) 59 .8 ( 15. 7) 73.8 (13 .4) 223 (60.6) 56 .2 ( 15. 0) 80.0 ( 15. 4) 171 (55 .5) 56 .4 ... for an evaluation of the frequency and intensity of GERD symptoms, the GIS providing complimentary information in terms of the use of additional medication for GERD symptoms and the impact of ... Quality of Life Outcomes 2009, 7:60 Background Gastroesophageal reflux disease (GERD) is a chronic condition in which reflux of stomach contents causes troublesome symptoms and/or complications...
- 8
- 521
- 0
báo cáo hóa học: " Impact of gastroesophageal reflux disease on work absenteeism, presenteeism and productivity in daily life: a European observational study" doc
... (3.8) 192 (38.8) 50 5 2 65 (52 .5) 52 .5 ( 14. 3) 27 .4 (4 .5) 2.3 (3.0) 258 (51 .1) 52 5 303 (57 .7) 57 .2 ( 15. 2) 26.9 (4. 7) 6.1 (7.2) 233 (44 .4) 47 7 280 (58 .7) 59 .8 ( 15. 7) 28.0 (4. 3) 4 .5 (4. 7) 161 (33.8) ... (60.6) 56 .2 ( 15. 0) 27 .5 (4. 8) 6.0 (8.3) 196 (53 .3) 308 171 (55 .5) 56 .4 ( 15. 5) 28.0 (5. 8) 5. 7 (5. 8) 132 (42 .9) 58 (11.7) 256 (51 .7) 45 (9.1) 112 (22.6) 30 (6.1) 180 ( 35. 6) 211 (41 .8) 55 (10.9) 28 (5. 5) ... visit, n (%) First occurrence of reflux symptoms Recurrent symptoms after a remission period Persistence of reflux symptoms Follow-up visit (asymptomatic patient) Other Symptoms ≥2 days/week, n (%)...
- 7
- 410
- 0
báo cáo khoa học:" Impact of gastroesophageal reflux disease on daily life: the Systematic Investigation of Gastrointestinal Diseases in China (SILC) epidemiological study" potx
... Participants with reflux symptoms below the threshold for symptom-defined GERD (i.e mild reflux symptoms
- 9
- 310
- 0
báo cáo hóa học:" Psychometric validation of the Dutch translation of the quality of life in reflux and dyspepsia (QOLRAD) questionnaire in patients with gastroesophageal reflux disease" ppt
... visit (after months of maintenance treatment) [13] The study was performed in accordance with the ethical principles of the Declaration of Helsinki, the Good Clinical Practice and the Wet Medisch-Wetenschappelijk ... visit Symptoms were scored as follows: none (no complaints), mild (aware of symptom, but easily tolerated), moderate (discomforting symptom, sufficient to cause interference with normal daily activities ... received acute treatment for their symptoms with esomeprazole 40 mg once daily for 2, or weeks The length of acute treatment was dependent on the length of time taken to achieve sufficient symptom relief...
- 8
- 431
- 0
Báo cáo y học: "Usefulness of manufactured tomato extracts in the diagnosis of tomato sensitization: Comparison with the prick-prick method" pdf
... efficiency of commercial tomato extracts compared with prick-prick fresh tomatoes remains unknown The objective of the study was to compare the wheal sizes induced by prick tests containing freeze-dried ... [http://www.mercasa.es/nueva/revista/pdf83/tomate.pdf] Carnés J, López-Matas M, Ferrer A, Larramendi C, Huertas J, Casanovas M, Fernández-Caldas E: Immunochemical Characterization Publish with Bio Med Central ... Ferrer A, Carnés J, Gallego MT, Andreu C, Fernández-Caldas E: Characterization and improvement of apple extracts for the diagnosisof apple IgE-mediated allergy Ann Allergy Asthma Immunol 20 05, ...
- 8
- 259
- 0
Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"
... samples from 200 patients with presumptive diagnosis of brucellosis which were sent to Central Microbiology Laboratory of Selcuk University Meram Faculty of Medicine from various clinics were included ... identified Acknowledgement This study was supported by a scientific research fund of Selçuk University School of Medicine Conflict of Interest The authors have declared that no conflict of interest ... Pinedo A, Smith HL Comparison of a Dipstick Assay for Detection of Brucella-Specific Immunoglobulin M Antibodies with Other Tests for Serodiagnosis of Human Brucellosis Clinical And Diagnostic Laboratory...
- 5
- 604
- 0
Báo cáo y học: " the Value of Serum Biomarkers (Bc1, Bc2, Bc3) in the Diagnosis of Early Breast Cancer"
... approaches for identification of serum biomarkers to detect breast cancer Clin Chem 2002 ;48 (8): 1296–13 04 27 Mathelin C Cromer A, Wendling C, Tomasetto C, Rio MC: Serum biomarkers for detection of ... JAMA 1999;281: 147 0–2 24 Smith RA, Cokkinides V, Eyre HJ American Cancer Society guidelines for the early detection of cancer, 20 04 CA Cancer J Clin 20 04; 54 :41 52 25 Chan DW, Sell S Tumor markers ... SELDI-TOF-MS to Discriminate Transitional Cell Carcinoma of the Bladder Cancer from Noncancer Patients Eur Urol 20 05; 47 (4) : 45 6 46 2 16 Wilson LL, Tran L, Morton DL, Hoon DS: Detection of differentially...
- 8
- 584
- 0
Báo cáo y học: "MALDI-TOF MS Combined With Magnetic Beads for Detecting Serum Protein Biomarkers and Establishment of Boosting Decision Tree Model for Diagnosis of Colorectal Cancer"
... samples and 15 CRC samples (Figure 5) Table The 68 discriminating m/ z peaks among CRC and normal controls m/ z 56 35. 3 42 84 .5 2870 7* 44 76 .5 9180 .5* 28 94. 6 30 84* 4 45 2 .9 52 13 49 45 . 9 9713 .5 856 4. 3 ... 45 9 9.1 6837 .5 2 949 .1 340 0.7 3817 .5 59 05. 1 3219 .4 61 94. 6 47 03.3 2686.1 55 45 . 4 13270.1 49 85. 2 55 04. 8 p 1.2×10 -5 1 .5 10 -5 1.9×10 -5 2.1×10 -5 2.3×10 -5 2 .4 10 -5 2.9×10 -5 3.3×10 -5 3.8×10 -5 4. 1×10 -5 4 .5 10 -5 ... 5. 1×10 -4 5. 5×10 -4 5. 7×10 -4 5. 8×10 -4 6 .5 10 -4 6.6×10 -4 7.0×10 -4 7 .5 10 -4 N/A m/ z 41 12.6 4 159 .9 7628 .5 64 35. 3 756 4. 4 3692 .4 7 839. 8 9 342 .9 240 92.6 42 99.3 7 941 153 09 2821 .5 N/A p 8.6×10 -4 8.9×10 -4 9.1×10-4...
- 9
- 530
- 1
Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"
... HCV v2.0 Roche Molecular Systems Roche Molecular Systems Bayer HealthCare Manual RTPCR 50 IU/ml NA Semiautomated RT-PCR Manual TMA 50 IU/ml NA 10 IU/ml NA Roche Molecular Systems Roche Molecular ... observed according to the presence or absence of either marker The presence of HCV RNA in the absence of anti-HCV antibodies is strongly indicative of acute HCV infection, which will be confirmed by ... polymerase chain reaction, TMA : transcription-mediated amplification, bDNA : “branched DNA“, NA : not applicable *for 0.2 ml or 0 .5 ml of plasma analyzed, respectively Assay Manufacturer Amplicor®...
- 6
- 612
- 0
Báo cáo y học: "Advances in Molecular Diagnosis of HBV Infection and Drug Resistance"
... different commercial and non-commercial testing methods for detection of drug resistance Sensitivity1/ Early detection Genotypic Methods Direct Sequencing RFLP RT-PCR LiPA Florescence MALDI-TOF ... among different methodologies Useful marker of infectivity in presence of precore/core promoter Relatively slower to detect drug resistance mutants Confirmation of spontaneous remission or co-infection ... standards [5] Commercial assays that make use of semiautomated systems can overcome these limitations [2 ,5] In contrast to PCR tests that measure HBV DNA titers only after completion of the PCR cycle...
- 9
- 590
- 0
Báo cáo y học: "Laboratory diagnosis of Toxoplasma gondii infection"
... gondii DNA on a small amount of 136 sample as it was in our experience (
- 2
- 460
- 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT GCTGCCACCCGTAGGTGT Reference Lane (1991) Lane (1991) This study This study Crocetti ... Candidatus ‘Accumulibacter phosphatis’ Most eubacteria Planctomycetales Verrucomicrobiales Sequence (5' !3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC ... PCR as shown in Table Sequence of PAO 65 1f is the reverse complement sequence of PAO 651 probe Sequence of PAO 846 r is the same sequence of PAO 846 probe For the quantitative PCR, LightCycler (Roche)...
- 7
- 719
- 0
Tài liệu Role of diffusion-weighted imaging in the diagnosis of gynecological diseases pdf
... adjacent myometrium [ 34 38] Therefore, intravenous dynamic contrast enhancement is necessary at MRI study of endometrial carcinoma The reported diagnostic accuracy of dynamic contrast-enhanced MRI ... numbers of patients and long-term follow-up is needed to establish the accuracy of ADC measurement for uterine endometrial cancer Uterine myometrium In order of frequency, malignant tumors of ... decrease in the ADC [21, 22, 28, 49 ] The mean ADC of mature cystic teratomas was lower than of malignant ovarian cystic tumors (Figs 6, 8) [22,23] The cystic components of mature cystic teratomas...
- 16
- 830
- 0
Tài liệu Diagnosis of smear-negative pulmonary tuberculosis in people with HIV infection or AIDS in resource-constrained settings: informing urgent policy changes docx
... algorithms.29 Methods of diagnosis Smear microscopy for acid-fast bacteria Microscopy for the detection of acid-fast bacilli is rapid, low cost, and speci c and detects the most infectious cases of ... improve sensitivity of smear microscopy for tuberculosis: a systematic review Lancet Infect Dis 2006; 6: 6 64 74 www.thelancet.com Vol 369 June 16, 2007 Public Health 41 42 43 44 45 46 47 48 49 ... CM, Reller LB Controlled comparison of BACTEC 13A, MYCO /F LYTIC, BacT/ALERT MB, and ISOLATOR 10 systems for detection of mycobacteremia J Clin Microbiol 2003; 41 : 1987–90 Katoch VM Diagnostic...
- 8
- 567
- 0
Tài liệu THE VALUE OF IMPROVED PUBLIC SERVICES: AN APPLICATION OF THE CHOICE EXPERIMENT METHOD TO ESTIMATE THE VALUE OF IMPROVED WASTEWATER TREATMENT INFRASTRUCTURE IN INDIA docx
... profile profile profile profile profile profile 3* 4* 0.7 144 0.67 15 1 0.00 34 0 .47 07 0.7 144 0.67 15 1 0.00 34 0 .47 07 0.7 144 0.67 15 1 0.00 34 0 .47 07 *significance at percent level The results of the ... 72 (4) , pp 51 9 -53 7 Colombo, S., N Hanley, J Calatrava-Requena (20 05) , “Designing Policy for Reducing the Off-farm Effects of Soil Erosion Using Choice Experiments”, Journal of Agricultural Economics, ... programme alternative, and the vector of coefficients to l are attached to the vector of interaction terms (S) that influence utility Since household characteristics are constant across choice occasions...
- 40
- 472
- 1
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot
... primers used were 5' -TCCGCTGCCAGTCGTCTTCC-3' and 5' -GTCCTCGCGAGTCTAGGCCA-3' Forty cycles of amplification were performed using an initial denaturation step of 95 C for five minutes, followed by denaturation ... Ravetkar, former Chief Medical Officer, Pune Municipal Corporation, Dr Nagkumar K, Chief Medical Officer, Pimpri Chinchwad Municipal Corporation, Dr Dileep Jagtap, Tuberculosis Control Program Officer, ... S Comprehensive evaluation of performance, laboratory application, and clinical usefulness of two direct amplification technologies for the detection of Mycobacterium tuberculosis complex Am...
- 8
- 524
- 0
ASSESSMENT OF DIAGNOSIS OF PULMONARY TUBERCULOSIS BY SPUTUM MICROSCOPY IN A DISTRICT TUBERCULOSIS PROGRAMME pdf
... observed Material was collected from the field over a period of 18 months commencing from September, 1963 The number of specimens collected at each centre and the proportion of positive among them are ... duplicate smear examination, for different centres, could be attributed mainly to chance fluctuations in sampling of specimens for smear preparation and intra-reading differences of NTI technician ... sputum examination at a centre, efficiency of supervision, type of corrective actions taken etc Efficiency is likely to be adversely affected by transfer of trained personnel and their replacement...
- 12
- 416
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25