diagnosis management and treatment of hepatitis c an update

Diagnosis, Management, and Treatment of Hepatitis C: An Update docx

Diagnosis, Management, and Treatment of Hepatitis C: An Update docx

Ngày tải lên : 08/03/2014, 14:20
... Americans The prevalence in the U.S of anti-HCV is higher in African Americans (3%) than in non-Hispanic whites, (1.5%) and Hispanics (1.3%).7 Compared to Caucasians, African Americans tend to have ... prevalence of HIV/HCV coinfection, and because the management of each infection can differ in dually-infected persons, all HIV-infected persons should be tested for HCV and all HCV-infected persons ... the HCV genome.48 Diagnosis of Acute and Chronic HCV Infection and Interpretation of Assays The diagnosis of acute or chronic HCV infection generally requires testing of serum for both antibody...
  • 40
  • 998
  • 0
báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot

báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot

Ngày tải lên : 11/08/2014, 12:21
... treated but not cleared, causes chronic infection and thereby increases the risk of liver failure and liver cancer HCV infection is also the major cause of liver transplantation It is consequently ... reactions, analysed data and co-wrote the paper MB advised and contributed to the statistical analysis of the data and co-wrote the manuscript DB conceptualized and designed the experiment, contributed ... the current standard of care The predictive value of SNPs is best calculated from routine clinical practice, rather than the clinical trial scenario, since these are the conditions in which most...
  • 13
  • 401
  • 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Ngày tải lên : 20/02/2014, 01:20
... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...
  • 15
  • 597
  • 0
Tài liệu GLOBAL STRATEGY FOR THE DIAGNOSIS, MANAGEMENT, AND PREVENTION OF CHRONIC OBSTRUCTIVE PULMONARY DISEASE pptx

Tài liệu GLOBAL STRATEGY FOR THE DIAGNOSIS, MANAGEMENT, AND PREVENTION OF CHRONIC OBSTRUCTIVE PULMONARY DISEASE pptx

Ngày tải lên : 21/02/2014, 12:20
... Occupational Dusts and Chemicals: Occupational exposures are an underappreciated risk factor for COPD14 These exposures include organic and inorganic dusts and chemical agents and fumes An analysis ... differences in survey methods, diagnostic criteria, and analytic approaches3,4 Survey methods can include: DO (value of health care resources devoted to diagnosis and medical management) and indirect ... read: Pneumococcal polysaccharide vaccine is recommended for COPD patients 65 years and older and has been shown to reduce the incidence of community- subgroup analysis of a randomised controlled...
  • 117
  • 697
  • 2
DIAGNOSIS, SCREENING AND TREATMENT OF ABDOMINAL, THORACOABDOMINAL AND THORACIC AORTIC ANEURYSMS pptx

DIAGNOSIS, SCREENING AND TREATMENT OF ABDOMINAL, THORACOABDOMINAL AND THORACIC AORTIC ANEURYSMS pptx

Ngày tải lên : 28/06/2014, 05:20
... Jiménez and Francisco Morant Chapter 17 Isolated Iliac Artery Aneurysm 293 Shinichi Hiromatsu, Atsuhisa Tanaka and Kentarou Sawada Chapter 18 Concomitant Abdominal Aortic Aneurysm and Malignancy: ... defined as an aortic diameter  3cm If clinically important aneurysms are only taken into account (AAA Diagnosis, Screening and Treatment of Abdominal, Thoracoabdominal and Thoracic Aortic Aneurysms ... Aortic Aneurysm Repair Michiel L.P van Zeeland and Lijckle van der Laan Chapter 14 Abdominal Aortic Graft Infection 227 Dimitrios Tsapralis, Anestis Charalampopoulos and Andreas M Lazaris Chapter...
  • 424
  • 366
  • 0
MELANOMA IN THE CLINIC – DIAGNOSIS, MANAGEMENT AND COMPLICATIONS OF MALIGNANCY pot

MELANOMA IN THE CLINIC – DIAGNOSIS, MANAGEMENT AND COMPLICATIONS OF MALIGNANCY pot

Ngày tải lên : 28/06/2014, 05:20
... editions of InTech Books and Journals can be found at www.intechopen.com Contents Preface IX Part Chapter Melanoma Models and Diagnostic Techniques Acral Melanoma: Clinical, Biologic and Molecular ... Fig Clinical pictures of radial growth phase (a) and tumorgenic vertical growth phase (b) of AM Acral Melanoma: Clinical, Biologic and Molecular Genetic Characteristics a b c d Fig Dermoscopy of ... Tsuchida, T., Kawabata, Y & Tamaki, K (2004) Significance of dermoscopic patterns 14 Melanoma in the Clinic – Diagnosis, Management and Complications of Malignancy in detecting malignant melanoma...
  • 320
  • 416
  • 0
Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

Ngày tải lên : 12/08/2014, 04:21
... environment, and that stability of HCVcc is inversely correlated with temperature Effect of heat treatment on HCVcc infectivity To evaluate the sensitivity of HCVcc to heat treatment, aliquots of HCVcc ... for effective HCVcc inactivation Of note, the presence of human serum does not seem to affect the susceptibility of HCVcc to heat treatment Effect of UVC light irradiation on HCVcc infectivity ... third cell passage) The decay rate of HCVcc infectivity after UVC light irradiation was calculated as 0.067-log/sec and 0.041-log/ sec, for HCVcc in culture medium (A) and human serum (B), respectively,...
  • 12
  • 411
  • 0
cáo khoa học: " The European Society of Human Reproduction and Embryology guideline for the diagnosis and treatment of endometriosis: an electronic guideline implementability appraisal" ppsx

cáo khoa học: " The European Society of Human Reproduction and Embryology guideline for the diagnosis and treatment of endometriosis: an electronic guideline implementability appraisal" ppsx

Ngày tải lên : 10/08/2014, 10:23
... and Clinical Excellence NICE: The guidelines manual 2007, Ref Type: Report 37 American College of Cardiology Foundation and American Heart Association: Methodologies and Policies from the ACC/AHA ... and evidence in changing clinical practice BMJ 1997, 315:418-421 Franssen MT, Korevaar JC, van d V, Boer K, Leschot NJ, Goddijn M: Management of recurrent miscarriage: evaluating the impact of ... researchers from the department of Obstetrics and Gynaecology (LD and WN) and two experts in quality of care (JB and CM), one of whom had special expertise with the eGLIA instrument (CM), participated...
  • 8
  • 481
  • 0
Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx

Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx

Ngày tải lên : 13/08/2014, 13:20
... threshold of 1.39, an area under curve of 0.93, and a sensitivity, a specificity, a PPV, and a NPV rate of respectively 91%, 89%, 91%, and 89% (P was non-significant for all areas under ROC curves comparisons.) ... Positive predictive evidence early in the course of treatment could be used for reinforcing the importance of compliance in ensuring a successful outcome Conversely, negative predictive capability ... R, Sacchi P, Ciappina V, Zochetti C, Patruno S, Maiocchi L, Filice G: Viral dynamics and pharmacokinetics of peginterferon alpha-2a and peginterferon alpha-2b in naive patients with chronic hepatitis...
  • 5
  • 322
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Ngày tải lên : 06/03/2014, 01:20
... Chronic hepatitis B and chronic hepatitis C are serious and can result in liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic ... prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection ... analysis LIVER CANCER AND LIVER DISEASE FROM CHRONIC HEPATITIS B VIRUS AND HEPATITIS C VIRUS INFECTIONS Both chronic HBV and HCV infections can lead to HCC, a type of liver cancer, and liver disease...
  • 191
  • 457
  • 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Ngày tải lên : 06/03/2014, 01:20
... liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are ... vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates than non-Hispanic white children Regarding vaccination of children and adults under ... analysis Liver Cancer and Liver Disease From Chronic Hepatitis B Virus and Hepatitis C Virus Infections Both chronic HBV and HCV infections can lead to HCC, a type of liver cancer, and liver disease...
  • 253
  • 369
  • 0
Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

Ngày tải lên : 08/03/2014, 02:20
... closure), and intradomain and side-chain conformational changes, occur upon binding of ATP and nucleic acid to ensure ATPase activity Analysis of the mode of binding of ATP in the HCV NTPase/helicase ... truncated 159 aa from the amino terminus, was amplified by PCR using the following primers: forward, 5¢-CATGCC ATGGCGCCATTTTTCTTGAGACATGCC-3¢; reverse, 5¢-CTGGGATCCGTCCGAATCAGGTTCCTTC-3¢ (purchased ... act as such, and it has been proposed that their mechanism of action is via inhibition of the products of the human cytomegalovirus genes UL89 and UL56 [49] It is, however, of some significance...
  • 9
  • 659
  • 0
Management of hepatitis C pot

Management of hepatitis C pot

Ngày tải lên : 08/03/2014, 14:20
... estimated from the prevalence of chronic hepatitis C (CHC).63 Acute hepatitis C infection is usually asymptomatic 64 The full clinical spectrum of acute hepatitis C symptoms can occur but is rare (
  • 55
  • 323
  • 0
Lung cancer - The diagnosis and treatment of lung cancer pdf

Lung cancer - The diagnosis and treatment of lung cancer pdf

Ngày tải lên : 15/03/2014, 00:20
... cases, and non-small-cell lung cancers (NSCLC), which account for the other 80% Non-small-cell lung cancers include squamous cell carcinomas (35% of all lung cancers), adenocarcinomas (27%) and ... bone scan or an MRI scan should be offered D(GPP) 1.3.2 Small-cell lung cancer (SCLC) 1.3.2.1 SCLC should be staged by a contrast-enhanced CT scan of the patient’s chest, liver and adrenals and ... lung cancer 41 Introduction In England and Wales, nearly 29,000 deaths were attributed to lung cancer in 2002 Lung cancer is the most common cause of cancer death for men, who account for 60% of...
  • 41
  • 470
  • 0
Improving the diagnosis and treatment of smear-negative pulmonary and extrapulmonary tuberculosis among adults and adolescents pdf

Improving the diagnosis and treatment of smear-negative pulmonary and extrapulmonary tuberculosis among adults and adolescents pdf

Ngày tải lên : 15/03/2014, 03:20
... the purposes of diagnosis and management • More research about the effectiveness and use of an antibiotic trial in the diagnostic algorithm and the choice of antibiotics, par-  Recommendations ... account the expected weight gain of pregnancy c Some additional specific conditions can also be included in regional classifications (e.g reactivation of American trypanosomiasis (meningoencephalitis ... basic diagnosis and management of tuberculosis and HIV, and completion of study documents Supplies and equipment necessary for the implementation of the revised guidelines will be installed and...
  • 44
  • 455
  • 0
Thuốc chống viêm ức chế lipooxygenase và cyclooxygenase dùng dự phòng và điều trị ung th- (LOX an COX - inhibitors as adjunctive therapies in the prevention and treatment of cancer) ppt

Thuốc chống viêm ức chế lipooxygenase và cyclooxygenase dùng dự phòng và điều trị ung th- (LOX an COX - inhibitors as adjunctive therapies in the prevention and treatment of cancer) ppt

Ngày tải lên : 20/03/2014, 03:20
... arachidonic qua nhiều chế, nh: - Đẩy acid arachidonic khỏi phospholipd màng - c chế tổng hợp acid arachidonic từ acid linoleic - C nh tranh với acid arachidonic vị trí hoạt hoá LOX COX, c nh ... vật, curcumin làm tăng thời gian 97 TCNCYH 25 (5) 2003 sống động vật gặm nhấm mà c ghép mảnh u c, c chế phát triển khối u, ngăn c n di B c đầu, thấy curcumin c t c dụng hiệp đồng với thu c hoá ... (Theaceae) - Allium species (tỏi) - Licorice, glycyrrhiza glabra L (Fabaceae) TCNCYH 25 (5) 2003 Mỡ c Mỡ c biển béo giàu eicosa - penta - en oic acid (EPA) decoxa - hexa - en - oic acid (DHA),...
  • 4
  • 1K
  • 2
KDIGO Clinical Practice Guideline for the Diagnosis, Evaluation, Prevention, and Treatment of Chronic Kidney Disease-Mineral and Bone Disorder (CKD-MBD) pdf

KDIGO Clinical Practice Guideline for the Diagnosis, Evaluation, Prevention, and Treatment of Chronic Kidney Disease-Mineral and Bone Disorder (CKD-MBD) pdf

Ngày tải lên : 22/03/2014, 09:20
... outcome Surrogate outcome Slowing of calcification Less calcification Slowing of calcification Slowing of calcification Clinical outcome Clinical outcome Clinical outcome Less CVD risk Less CVD ... Inflammation and Coronary Calcification BV Bone volume CAC Coronary artery calcification CaR Calcium-sensing receptor Ca  P Calcium–phosphorus product CI Confidence interval CKD Chronic kidney disease CKD–MBD ... use of biochemical assays for the diagnosis and management of CKD–MBD requires some understanding of assay characteristics and limitations, discussed by each assay below The understanding of these...
  • 140
  • 777
  • 1
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Ngày tải lên : 22/03/2014, 17:20
... resources and guidance to perinatal hepatitis B prevention program coordinators to expand and enhance the capacity to identify chronically infected pregnant women and provide case -management services, ... and hepatitis C, and conduct targeted active surveillance to monitor incidence and prevalence of hepatitis B and hepatitis C in populations not fully captured by core surveillance Immunization ... Baltimore, Maryland Lester N Wright Deputy Commissioner and Chief Medical Officer, New York Department of Correctional Services, Albany, New York Sandral Hullett CEO and Medical Director, Cooper Green...
  • 4
  • 404
  • 1
Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

Ngày tải lên : 22/03/2014, 18:20
... case-finding and treatment in Mwanza, Tanzania Int J Tuberc Lung Dis 2000; 4: 133-38 13 MacIntyre CR, Plant AJ, Hulls J et al: High rate of transmission of tuberculosis in an office: impact of delayed ... of infection in a community [5,6] Delays in the diagnosis and start of effective treatment of tuberculosis patients result in a prolonged period of infectivity in the community and health care ... differences between groups RESULTS The present study was conducted at the SSK Süreyyapal Center for Chest Disease and Thoracic Surgery, ba consisting of 1600 beds We reviewed the clinic records of...
  • 6
  • 466
  • 0
UPDATES IN THE DIAGNOSIS AND TREATMENT OF VASCULITIS pot

UPDATES IN THE DIAGNOSIS AND TREATMENT OF VASCULITIS pot

Ngày tải lên : 30/03/2014, 00:20
... and Alexandros Sarantopoulos Chapter Giant Cell Arteritis and Arteritic Anterior Ischemic Optic Neuropathies 111 Dragos Catalin Jianu and Silviana Nina Jianu Chapter Infectious Causes of Vasculitis ... the strict criteria of Goodman and Churg [15] In the early 1970s, Fauci and Wolff introduced treatment with cyclophosphamide and corticosteroids for WG, which resulted in a nearly complete and longlasting ... and renal injury in AAV Enhanced cellular autoimmunity and innate cells stimulate B cells resulting in the production of antigen specific ANCAs These auto-antibodies bind to and activate circulating...
  • 282
  • 1.1K
  • 0