development deployment and usability of a point of care decision support system for chronic disease management using the recently approved hl7 decision support service standard
báo cáo khoa học: " Usability evaluation of a clinical decision support tool for osteoporosis disease management" pps
... behaviour as they interacted with the RAQ Data collection and analysis consisted of a combination of qualitative analysis to assess the effect of technology on participant reasoning and decision- making, ... systems and user interfaces and provide information about the process of using a system to characterize decision- making, reasoning skills, and the information-processing needs of participants as they ... direct observation of participants Quantitative data Quantitative data were analysed using frequency analysis of demographic questions, task accuracy, and frequency and classes of problems encountered;...
- 12
- 362
- 0
báo cáo khoa học: " Evaluation of a clinical decision support tool for osteoporosis disease management: protocol for an interrupted time series design" ppt
... prevalence of chronic diseases [40] and increase the awareness and the need for patient self -care to support chronic disease management [40,41] As a result, there is a shift toward a new patient-physician ... this information and a management plan with their family physician at the point of care We believe that this component is an important step toward improved self -management Self -management strategies ... benefit may include an increased awareness for patients about osteoporosis and its associated risks, the availability of relevant information about what they can about these risks, and the opportunity...
- 7
- 436
- 0
A CASE BASED DECISION SUPPORT SYSTEM FOR INDIVIDUAL STRESS DIAGNOSIS USING FUZZY SIMILARITY MATCHING
... similar cases may lead to less informed decision The reliability and accuracy of the diagnosis systems depend on the storage of cases/experiences and on the retrieval of all relevant cases and their ... also of importance for the clinicians A standardization of the slope that is using negative and positive angles makes it more visualise and gives a terminology to a clinician for reasoning about ... relevant features are extracted automatically from the outcome of the calibration phase Finally, these extracted features thereafter help to formulate a new problem case and passed to the case-based...
- 13
- 567
- 0
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... Example data is shown in Table 3.1 Task-related information Despite the Qualifications and other measures taken in the collection phase of the corpus, we believe the quality of the data remains ... between the workers was to compare the ids of the selected sentences The agreement was calculated as follows: each answer was compared to all the other answers for the same question For each case, the ... which are not asked, and also contain practical examples Human-powered answers often contain unrelated information and discourselike elements Additionally, the answers not always have a connection...
- 9
- 610
- 1
cáo khoa học: " Understanding organisational development, sustainability, and diffusion of innovations within hospitals participating in a multilevel quality collaborative" pps
... start of the planning and control cycle and serve as a frame of reference for CEOs, management, and staff Performance contracts are made with unit heads to stimulate the adoption of lessons learned ... interpreting the data; and drafting the manuscript As project leader of the independent programme evaluation, CW was responsible for the design of the study LV acquired and analysed MQC data CW, LV, and ... Questionnaire and dissemination table (see additional file 1) For the last 15 years, a validated measuring instrument has been used to measure the developmental stage of the quality -management systems...
- 10
- 182
- 0
Diagnosis of pulmonary tuberculosis by smear microscopy and culture in a tertiary health care facility: Biology and Medicine docx
... Science, Jazan University, Jazan, Kingdom of Saudi Arabia *Corresponding Author: kismail@jazanu.edu.sa, sayeedkhatib@hotmail.com Abstract Smear microscopy and culture forms the backbone of tuberculosis ... (TB) laboratory investigations in tertiary healthcare facilities which have a large number of cases and financial constraints The present study aimed to re-evaluate the efficiency of smear microscopy ... diagnostic methods are a continuing necessity The acid-fast smear has been used as an aid in the diagnosis of mycobacterial disease for many years It is the simplest procedure currently available...
- 6
- 465
- 0
báo cáo hóa học:" Estimating the cost of care giving on caregivers for people living with HIV and AIDS in Botswana: a cross-sectional study" doc
... such as mealie meal and food baskets and loans for Page of income-generating activities, and lending a sympathetic ear to their plight will help boost the morale of caregivers and attract others ... out the reservation wage of the caregiver Estimating the opportunity cost of giving care by the caregiver takes into consideration the caregiver's educational status and the income the caregiver ... was assessed by staff in the Nursing and Statistics departments at the University of Botswana, while the staff of the Community Home-Based Care Programme of the Ministry of Health, Botswana, assessed...
- 8
- 384
- 0
báo cáo hóa học:" Quality of data collection in a large HIV observational clinic database in sub-Saharan Africa: implications for clinical research and audit of care" docx
... guidelines for adults and children edition Kampala, Uganda: Ministry of Health, Republic of Uganda; 2003 Kamya MR, Mayanja-Kizza H, Kambugu A, Bakeera-Kitaka S, Semitala F, Mwebaze-Songa P, Castelnuovo ... data items in these databases This evaluation is particularly timely and relevant with the expanding use of observational databases to assess the optimal timing of ART initiation, and the establishment ... Diseases Institute (IDI) in Kampala, Uganda, is a centre of excellence for HIV clinical care in the country, and maintains a large observational clinic database and a nested research cohort database...
- 7
- 455
- 0
Báo cáo hóa học: " Research Article Development and Evaluation of High-Performance Decorrelation Algorithms for the Nonalternating 3D Wavelet Transform" pdf
... overall performance gains of such systems Regarding the 3D wavelet transform, Kutil and Uhl have conducted a study of the software and hardware needs of the 3D wavelet transform [14] They have ... evaluated a parallel algorithm for computing the three-dimensional FFT They have also found out that the I/O mechanisms play a central role on the performance of the overall parallel systems They ... transforms Some efforts have focused on special architectures for the fast computation of some of these transforms For instance, in [10] Modarressi and Sarbazi-Azad have proposed an algorithm for the...
- 11
- 443
- 0
Báo cáo khoa học: "Skin cancers in albinos in a teaching Hospital in eastern Nigeria - presentation and challenges of care" ppt
... cancers are indeed a major cause of morbidity amongst albinos in the tropics These patients from a young age face a raging battle against these cancers; a battle the African albino often appears ... http://www.wjso.com/content/8/1/73 There is therefore a need for persons with albinism as well as healthcare providers at all levels of care to be enlightened on the health needs of the albino The head and neck region was the ... offering Plastic surgery services to the Eastern and Southern parts of Nigeria Nigeria is the most populous nation in sub-Saharan Africa and the most populous black nation in the world with a...
- 6
- 290
- 1
Báo cáo y học: "Understanding uptake of continuous quality improvement in Indigenous primary health care: lessons from a multi-site case study of the Audit and Best Practice for Chronic Disease project" ppt
... address Others raised these same issues but saw the information as an advantage because data could be aggregated at a regional level for analysis and addressed as part of broader policy and program ... of national clinical guidelines for diabetes care, the release of the national chronic disease policy, the National Strategic Framework in Aboriginal and Torres Strait Islander Health, and a number ... in Canada, Australia, and New Zealand The Lancet 2007, 9527(367):2029-2031 31 Anderson I: Recent developments in national Aboriginal and Torres Strait Islander health strategy Australia and New...
- 14
- 440
- 0
Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" doc
... 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori H, Maruta A, Okamoto S, Sakamaki H: Human herpesvirus ... patients care, PS interpreted the chest-CT and the MRI and added the figures, BM wrote the paper and all authors read and approved the final manuscript Authors' information G.J and B.M are attending ... Bronchoalveolar lavage was positive for HHV6b too and negative for Adenovirus, Influenza, Parainfluenza, Respiratory syncytial virus and Legionella pneumophilia Immediate treatment with foscarnet and...
- 3
- 366
- 0
Báo cáo khoa học: " Challenging complications of treatment – human herpes virus 6 encephalitis and pneumonitis in a patient undergoing autologous stem cell transplantation for relapsed Hodgkin''''s disease: a case report" ppsx
... 52:275-280 Fujimaki K, Mori T, Kida A, Tanaka M, Kawai N, Matsushima T, Kishi K, Fujisawa S, Sakura T, Yokota A, Kanda Y, Taguchi J, Akiyama H, Kanamori H, Maruta A, Okamoto S, Sakamaki H: Human herpesvirus ... patients care, PS interpreted the chest-CT and the MRI and added the figures, BM wrote the paper and all authors read and approved the final manuscript Authors' information G.J and B.M are attending ... Bronchoalveolar lavage was positive for HHV6b too and negative for Adenovirus, Influenza, Parainfluenza, Respiratory syncytial virus and Legionella pneumophilia Immediate treatment with foscarnet and...
- 3
- 303
- 2
Báo cáo y học: "Development and application of versatile high density microarrays for genome-wide analysis of Streptomyces coelicolor: characterization of the HspR regulon" ppsx
... 5'-ATGCCGGGCGACGTGCTAAA; SCO3202 forward primer 5'-CTGATCCAGGAGGGCAAC, reverse primer 5'-GCGTACGTGGAGAACTTGAA, and dual labeled probe 5'-TCCGCGCGGTCGAGAAGTTC; SCO4157 forward primer 5'-GACGTACAAGGCGATCCAG, ... assay reaction The dnaK biotinylated probe used in gel shift assays was 5'TGCACACTTGAGCCTGTTCCACTCAAGTCAGCTGGAG; the SCO5639 biotinylated probe was 5'-TCGGATTGGAATTACTAAGATTCAGGATGCAGCACGCATCGT ... gene, was induced SCO3661 -79 GCCCGACTCCTTGAGTGGCCCTGACTCAACTTTGTGTACGCTGGACGAG -31 SCO5285 -51 CTCCCTTTCATTGAGTCGATGTAACTCAACTTGACTGCCGAAGGGGAGA -3 SCO3671 -102 CGGATAAGAGTTGAGTCCGCTCGACTCACCTCTGTTGACCCATCGCCGG...
- 14
- 482
- 0
Development, evaluation and optimization of image based methods for monitoring crystallization processes
... batch crystallization run, the solid concentration typically increases as the crystals nucleate and grow The imaging system thus acquires blank images (of the background) at the beginning, and ... extract information reliably from the images deteriorates considerably As an additional complication, at high solid-concentrations, the crystals may aggregate or agglomerate, making accurate particle ... demonstrates the experimental setup and the detailed experimental procedures In Chapter 5, the metrics for evaluating PVM imaging system and IA methodology are introduced, and evaluated with sea sand...
- 214
- 279
- 0
Development of liquid crystal based system for biomolecule and nanomaterial characterization
... transmitted through the analyzer are a function of the anchoring of the LC molecules within the sample, the orientation of the sample between the polarizers, and the orientation of the polarizers ... between nanomaterials and cell membrane, which may provide the necessary information for establishing nanotoxicity pathway as well as for designing better nanomaterials with improved performance and ... crystals The anchoring angle of LCs can be described by a polar angle, θ, and an azimuthal angle, φ Polar angle is the angle between the director, d, and the normal to the surface, y (Figure 2. 7A) ...
- 180
- 384
- 0
Development and application of novel capillary electrophoresis techniques for analysis of DNA fragments and organic pollutants
... is the total spatial variance of the concentration profile for a zone If the peaks acquired are symmetrical and have Gaussian profile, the theoretical plate number can also be calculated from the ... effectiveness and miniaturization, and therefore has great potential for on-site analysis of various pollutants at trace level CE is found to be a versatile analytical tool for the analysis of DNA as well ... with a series of publications by Jorgenson and Lukacs [1-3], there has been a rapid development of CE as an analytical technique The popularity of the use of CE in various analytical fields has...
- 223
- 752
- 0
Bơm ECD-V - P - Composition and Construction of ECD-V3 Pump System
... higher level of precision It consists of a spool valve and a solenoid coil The spool valve, which acts directly in accordance with electric signals, opens and closes the passage that links the pressure ... 2 Operation of ECD-V3 Pump 2-1 Fuel Suction and Injection The mechanism for the suction and pumping/distribution of the fuel is basically the same as for the previous distributor ... pump with the pressure chamber, is a type of solenoid valve that turns ON/OFF (opens and closes) in accordance with the signals from the engine ECU When the coil of the solenoid spill valve is...
- 4
- 729
- 5
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25