design and development of a product

DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

Ngày tải lên : 29/03/2014, 11:20
... input parameters and provide you automatically with a schematic dia- gram and calculate capacitor and resistor values for specific filter implementations. This doesn’t mean that the programs will ... 12:35 PM Page xiv In memory of Prof. Mircea Arcan, who was a caring teacher, a true friend, and a most compassionate human being. —David ffirs.qxd 11/22/2004 9:46 AM Page v 1 1 Design and Development ... a capacitance of 5000 pF at 12 BIOPOTENTIAL AMPLIFIERS Figure 1.10 Block diagram of a typical capacitive active bioelectrode. A highly dielectric material is used to form a capacitive interface...
  • 478
  • 521
  • 2
The Design and Implementation of a Log-Structured File System

The Design and Implementation of a Log-Structured File System

Ngày tải lên : 12/09/2012, 15:05
... The bandwidth of each of the five phases is shown separately. Sprite LFS has a higher write bandwidth and the same read bandwidth as SunOS with the exception of sequen- tial reading of a file that ... log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data area is ... in part by the National Aeronautics and Space Administration and the Defense Advanced Research Projects Agency under contract NAG2-591. This paper will appear in the Proceedings of the 13th ACM...
  • 15
  • 1.4K
  • 0
Design and Implementation of a Three-Phase Induction Motor Control Scheme

Design and Implementation of a Three-Phase Induction Motor Control Scheme

Ngày tải lên : 27/10/2013, 23:15
... A2 8 Gareth S Roberts 6. The MATLAB design The MATLAB design constructed is used to simulate the final FO control design where all parameters, processes and variables are modelled mathematically. ... mathematically. Furthermore, the MATLAB program can convert a MATLAB design into a C-code design in a relatively straightforward manner. Hence, this stage of the thesis project is seen to be of great ... induction machine is an electrical device. The electrical properties that are of particular interest to this thesis project are the stator and rotor’s resistance and inductance, as well as the magnetizing...
  • 93
  • 693
  • 1
Design and Simulation of A CMOS-MEMS Accelerometer

Design and Simulation of A CMOS-MEMS Accelerometer

Ngày tải lên : 27/10/2013, 23:15
... major parameters of the device. Only the ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a total sensing capacitance of 60fF. ... of 60fF. Parasitic capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4. The capac- itance ratios are derived from the ratios of driving signals and buffer ... C f1 and C f2 are reset to zero charge, and hold capacitors C h ’s are floating. During the Integrate 1 phase, the difference of charges on C i1 and C i2 are inte- grated to C f1 and C f2 , and...
  • 40
  • 588
  • 1
Tài liệu Design And Simulation Of A Cmos-Mems Accelerometer doc

Tài liệu Design And Simulation Of A Cmos-Mems Accelerometer doc

Ngày tải lên : 22/12/2013, 08:16
... performed on a probe station. Table 1 lists major parameters of the device. Only the ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming ... assuming a total sensing capacitance of 60fF. Parasitic capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4. The capac- itance ratios are derived from the ratios ... value of these parasitic capacitors is around 70fF, which is the same order as the total sensing capacitance. Parasitic capacitance of diodes and input transistors of buffers is relatively small,...
  • 40
  • 580
  • 0
Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Tài liệu Experiences in Design and Implementation of a High Performance Transport Protocol doc

Ngày tải lên : 15/01/2014, 15:59
... stream! Amsterdam Chicago 2 Chicago 1 Fairness and Friendliness 50 TCP flows and 4 UDT flows between SARA and StarLight Realtime snapshot of the throughput The 4 UDT flows have similar ... copy avoidance ã Overlapped IO ã Data scattering/gathering ã Speculation of next packet Protocol Buffer Protocol Buffer User Buffer Data New Data Experiences in Design and Implementation of a ... Internet AIMD (Additive Increase Multiplicative Decrease) ã Fair: max-min fairness ã Stable: globally asynchronously stable ã But, inefficient and not scalable In grid networks (with high bandwidth-delay...
  • 32
  • 580
  • 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

Tài liệu The Design and Performance of a Real-time CORBA Event Service doc

Ngày tải lên : 19/02/2014, 18:20
... implemen- tations and (2) automating many common network program- ming tasks, such as object registration, location, and acti- vation; request demultiplexing; framing and error-handling; parameter marshalling ... T. Ralya, B. Pollak, R. Obenza, and M. G. Har- bour, A Practitioner’sHandbook for Real-Time Analysis: Guide to Rate Monotonic Analysis for Real-Time Systems. Norwell, Massachusetts: Kluwer Academic ... Performance of a Real-time CORBA Event Service,” in Proceedings of OOPSLA ’97, (Atlanta, GA), ACM, October 1997. [3] G. Parulkar, D. C. Schmidt, E. Kraemer, J. Turner, and A. Kantawala, “An Architecture...
  • 20
  • 737
  • 0
Tài liệu Báo cáo khoa học: "DESIGN AND IMPLEMENTATION OF A LLXICAL DATA BASE " docx

Tài liệu Báo cáo khoa học: "DESIGN AND IMPLEMENTATION OF A LLXICAL DATA BASE " docx

Ngày tải lên : 22/02/2014, 09:20
... facilitates memorization. 152 DESIGN AND IMPLEMENTATION OF A LLXICAL DATA BASE Eric Wehrli Department of Linguistics U.C.L .A. 405 Hilgard Ave, Los Angeles, CA 90024 ABSTRACT This paper ... requirements" and has to do with the complexity of the task of creating a lexical entry. It can roughly be viewed as a measure of the time it takes to create a new lexical entry, and of the amount of ... For instance, a translation system or any other type of natural language processing program that must be able to handle very large amounts of text necessitates dictionaries of substantial size,...
  • 8
  • 535
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... (5Â-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3Â); for OR17-40 (5Â-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3Â) and (5Â-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3Â); ... was performed on DNAse- treated RNA extracts. Primers used for RT-PCR were: for the I7 OR (5Â-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3Â) and (5Â-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3Â); ... expression vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5Â-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG...
  • 14
  • 473
  • 0
The Design and Implementation of a Sequence Database System * docx

The Design and Implementation of a Sequence Database System * docx

Ngày tải lên : 16/03/2014, 16:20
... object-relational database system Illustra [I11941 provides database support for time-series data along with relational data. A time-series is an ADT(Abstract Data Type) value implemented a& amp; a large ... Catalog Management: Each E-ADT can provide catalogs that maintain statistics and store schema information. Further, certain values may be named. Query Language: An E-ADT can provide a query ... Livny and Raghu Ramakrishnan were supported by NASA Research Grant NAGW-3921. Raghu Ranxkish- nan was also suppofled by a Packard Foundation Fellowship in Science and Engineering, a Presidential...
  • 12
  • 568
  • 0
Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx

Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx

Ngày tải lên : 22/03/2014, 11:20
... Space Application, Bologna (Italy) (1979) 7A. [4] Dang Thi Thanh Thuy, Pham Van Thanh, Nguyen Anh Tuan, Bach Gia Duong, Research, Design And Fabrication Of The 45W And The 200W, L-Band Power Amplifier ... combination technique in the microwave technology. The design and simulink of the basic power moduls and Wilkinson bridge were performed using the ADS soflware. We have researched, designed and ... Bach Gia Duong 2 1 Faculty of Physics, College of Science, Vietnam National University Hanoi 2 Research Center Electronics and Telecommunication, College of Technology, VNU 3 Department of...
  • 5
  • 374
  • 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Ngày tải lên : 23/03/2014, 09:20
... metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline protei- nase of Pseudomonas aeruginosa, the ZapA metallo- protease of Proteus mirabilis and proetases A, B, C, G and W of various ... Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aerugi- nosa elastase. II. Kinetic analysis and identification of scissile ... (horizontal double arrows, A1 A5 ) in the sequence of insulin chain A. (B) Change over time in the chromatographic peak area of cleavage fragments. Note that the amount of frag- ments A1 , A2 and A4 ...
  • 11
  • 424
  • 0
the symbian os architecture sourcebook design and evolution of a mobile phone os

the symbian os architecture sourcebook design and evolution of a mobile phone os

Ngày tải lên : 01/06/2014, 11:21
... Private Network WAP Wireless Application Protocol WDP Wireless Datagram Protocol XIP Execute in place Glossary of Terms ABI Application binary interface ADT Abstract data type BAL Bearer Abstraction ... summer of 1994, Psion was a company of perhaps 40 software engineers and as many hardware engineers, with a product line of handheld organizers that was highly profitable. The most recent was the Psion ... followed by Asia, including Hong Kong, Australia and New Zealand. By the mid-1990s, new GSM networks had sprung up globally from the Philippines and Thailand to Iran, Morocco, Latvia and Russia, as well...
  • 633
  • 405
  • 0

Xem thêm