description of a treatment manual for in virtuo exposure with specific phobia
Báo cáo y học: "The Colombian conflict: a description of a mental health program in the Department of Tolima" pdf
... psychological care and treatment in Ibague, the capital of the department of Tolima, and in various rural villages Three mental health teams provided services: two were mobile within the rural areas and ... witnessing murders or physical abuse, having suffered the break up of the nuclear family and suffering family violence For adults treated in Ibague, having been forced to flee was the main traumatic ... responsibility for the accuracy of the data analysis GC and MRM participated in the interpretation of the results GC, SH, RFG and MRM participated in the critical revision of the manuscript All authors read...
- 6
- 317
- 0
Báo cáo y học: "Protein-lipid interactions: correlation of a predictive algorithm for lipid-binding sites with three-dimensional structural data" ppt
... sites as well as actin and vinculin binding sites [84,85] The isolated 47 kDa FERM-containing domain retains the lipid-binding capacity of intact talin and includes a primary integrin-binding site ... L-selectin, vinculin, and zyxin The peptides that interact with alphaactinin tend to be basic, alpha-helical, and appear to interact with the conserved acidic surface of the alpha-actinin rod [28] kinase ... chains, divided into three functional domains: an actin-binding region at the amino-terminus, a central alpha-actinin segment (rod), and a carboxyl-terminus containing two EF hands (generally a...
- 14
- 244
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... of mineral matter The nitrogen and carbon are most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily ... gives an illustration as to what care in milking will in the way of eliminating bacteria Fig 12 shows a gelatin plate seeded with the same quantity of milk that was used in making the culture indicated ... growing out into medium liquefying at surface; c, a rapid liquefying form; d, a gas-producing form that grows equally well in lower part of tube as at surface (facultative anaerobe); e, an obligate...
- 201
- 540
- 0
Báo cáo y học: " Reliability and predictive validity of a hepatitisrelated symptom inventory in HIV-infected individuals referred for Hepatitis C treatment." docx
... HCV treatment initiation, independent of standard of care clinical considerations The assessment was part of a multidisciplinary approach implemented within a comprehensive HIV primary care clinic ... determination regarding scale inclusion of items was based on factor loadings and investigator judgment regarding content and face validity for a putative subscale construct (Table 1) Internal consistency ... California at San Diego 200 West Arbor Drive, San Diego, California 92103 USA 2Department of Pharmacy, University of California at San Diego 200 West Arbor Drive, San Diego, California 92103 USA...
- 9
- 483
- 0
Multi-criteria Evaluation of Wastewater Treatment Scenarios for Small Towns in Developing Countries - Case Study of Toan Thang Town in Vietnam
... (2002) Improving Sanitation in Small Towns In Latin America and the Caribbean - Practical Methodology for Designing a Sustainable Sanitation Plan, Office of Health, Infectious Diseases and Nutrition, ... as small towns often have sufficient land for landintensive wastewater treatment technologies, as compared to urban areas Therefore, despite these drawbacks in attaining sustainability, Scenario ... for a sustainable wastewater treatment system Results indicated that the strength of MCA was not in the prescription of an “answer”, but rather in the provision of a transparent, traceable and informative...
- 23
- 779
- 0
Tài liệu Cyber Forensics—A Field Manual for Collecting, Examining, and Preserving Evidence of Computer Crimes ppt
... information are advised and encouraged to confirm specific claims for product performance as necessary and appropriate The legal/financial materials and information that are available for reference ... legal/financial counsel as may be appropriate for any matters to which the legal/financial materials and information may pertain Web sites included in this manual are intended to provide current and ... participates in the St Louis InfraGard chapter John W Rado is a geospatial analyst at National Imagery and Mapping Agency (NIMA) in St Louis, Missouri John has worked for NIMA since January of...
- 346
- 1,530
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG ... gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg...
- 9
- 497
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... was prepared by incubating catechol with resting cells of a mutant, strain Y-2, of the aniline-assimilating Pseudomonas sp strain AW-2 [20] Results Spectral changes during metabolism of 4-amino-3hydroxybenzoic ... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... decarboxylase) and a deamination step (2-aminomuconic 6-semialdehyde deaminase) in P fluorescens strain KU-7 [7] The decarboxylation mechanism in the metabolic pathways for 3-hydroxyanthralinic acid...
- 7
- 613
- 1
Tài liệu Management of Dead Bodies after Disasters: A Field Manual for First Responders docx
... identification of the dead has legal significance for inheritance and insurance that can impact on families and relatives for many years after a disaster This manual marks an important step toward ... Centralization and consolidation of information about the dead and missing is essential for increasing the possibility of finding a match between tracing requests for missing persons and available/known ... the financial support of the Division of Humanitarian Assistance, Peace and Security of the Canadian International Development Agency (HAPS/CIDA), the Office of Foreign Disaster Assistance of the...
- 58
- 450
- 2
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx
... metabolism of the allergen was altered as a result of the in ammation in the lungs of sensitized animals Up to now there are few data available on the fate of an allergen after inhalation In ... i.t instillation of [75Se]Der p instead of the last aerosol challenge at day 30 Analysis of BAL fluid from mice instilled with nonlabelled Der p at day 30 displayed an airway in ammation 18 h after ... the Sel-tag had an intact core sequence and maintained allergen-specific IgE-binding epitopes and the use of a Sel-tag enabled labelling with the gamma-emitting radionuclide 75Se at a single predefined...
- 12
- 518
- 0
REPRODUCTIVE CHARACTER DISPLACEMENT AND SPECIATION IN PERIODICAL CICADAS, WITH DESCRIPTION OF A NEW SPECIES, 13-YEAR pot
... black lateral band or center black, rarely with weak2 orange lateral band black, rarely with weak2 orange lateral band black with orange lateral band black and orange lateral band Dominant call ... 17-year cicadas (A) mutate (to a ) and join an overlapping, coemerging 13-year brood; Stage II: reinforcement occurs between a and a in the 13-year brood; Stage III: individuals of 13year a mutate ... shift Graph shows temporal change in a climate parameter such as temperature Pie charts indicate proportion of cicadas emerging in 17 years (light) and 13 years (dark) During stage A, all cicadas...
- 13
- 489
- 0
Evaluation of a diagnostic algorithm for smear-negative pulmonary tuberculosis in HIV-infected adults doc
... Table I Baseline data for the 58 smear-negative patients (continued) Characteristic Adenopathy Infiltrate and adenopathy Pleural effusion/thickening and infiltrates Pleural effusion and adenopathy ... suggestive of TB, but ADA is also raised in parapneumonic and malignant effusions CXR = chest radiograph; ADA = adenosine deaminase; CRP = C-reactive protein; Hb = haemoglobin unable to produce ... SAMJ Pg 517-523.indd 519 6/20/07 8:14:57 AM ORIGINAL ARTICLES Table I Baseline data for the 58 smear-negative patients Characteristic 520 Study participants (N) Age (years) Median Interquartile...
- 7
- 366
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... and cared for according to the American Association for Accreditation of Laboratory Animal Care guidelines The Wyeth Institutional Animal Arai et al Journal of Translational Medicine 2010, 8:51 ... were among the "inventoried" assays available from ABI, and are described in Table cDNA synthesis, preparation of samples for TLDA assay and measurements of RNA concentration were performed as ... pharmacokinetics and pharmacodynamics of RWJ 67657, a specific p38 mitogen-activated protein kinase inhibitor: a first-inhuman study J Clin Pharmacol 2003, 43:406-413 Arai et al Journal of Translational...
- 13
- 528
- 0
Establishment and evaluation of efficiency of the treatment model for managed detainees in provincialmunicipal hospitals (2011 2012)
... managed detainees in assigned area; The patient’s beds in private treatment wards, rooms for managed detainees are the beds of hospital; The medical staffs of hospitals treating for managed detainees ... State’s hospitals in area for treatment and examination 100% of close-settings have infirmary for health care service for managed detainees 100% of prison, close-setting and detention camp have ... of managed detainees are treated at the clinic are over 140,000 times of examinations and treatment 3.2.2.2 Deploy organizational model on clinic for managed detainees in municipal/ provincial...
- 24
- 257
- 0
Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps
... considerations for initiating MPH treatment At the start of treatment with any MPH formulation, careful dose titration is necessary IR and long-acting formulations of MPH can both be used to initiate ... treated with medication) The instrument also captures information on progress with learning and any emotional concerns A summary of discussions with the family is maintained, including an action ... walked late, talked late (age 3) and found mainstream schooling very challenging Patient 4’s parents separated when she was years old, and a shared contact arrangement with both parents was agreed...
- 24
- 597
- 0
Báo cáo khoa học: " Investigation of tumor hypoxia using a twoenzyme system for in vitro generation of oxygen deficiency" pot
... http:// angiogenesis.dkfz.de/oncoexpress/software/sumo/) was used for statistical analysis, two-class t-tests and GOanalysis Pathway analysis was performed based on information available on cellular ... analysis and data interpretation AA, UH, JD, SM and PEH were involved in critically revising the manuscript for important intellectual content and gave approval of the final version All authors have ... hypoxia in patients with advanced head and neck cancer randomly assigned to chemoradiation with or without tirapazamine: a substudy of Trans-Tasman Radiation Oncology Group Study 98.02 J Clin Oncol...
- 12
- 306
- 0
Báo cáo sinh học: "Optimal design for the detection of a major gene segregation in crosses" potx
... preliminary analysis of available data; and iv) retrospective studies of old experiments without marker information may be important for various valuable The basis for population genetics was established ... emphasized These curves are nearly linear for power under 70% and, in this linear part, the slope (ie the gain in power = = = per extra individual measured) increases with a The resulting increase ... heterogeneous AA or AB animals (BC1) and AB or BB animals (BC2) with proportions 1/2, 1/2 The statistical analysis of the data obtained from these populations was clearly described by Elston and Stewart...
- 11
- 368
- 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report" docx
... was placed in the anatomic position Part of the native head was used as a morselised autograft at the true acetabular bed The superolateral part of the head was used as a structural graft and secured ... technical difficulties of antegrade nailing due to the distorted anatomy and the limited ability of intraoperative traction and manipulation because of hip ankylosis in 15° of flexion and as a result ... 32 -A1 according to the AO-OTA classification [3] We performed a total hip arthroplasty via a posterolateral incision, using a long cementless Wagner stem [4] and a porous tantalum monoblock acetabular...
- 4
- 355
- 0
Báo cáo y học: " Development of a minimization instrument for allocation of a hospital-level performance improvement intervention to reduce waiting times in Ontario emergency departments" pps
... the intervention is supported by a leadership and training program and organizational change experts in the form of coaching and training teams who facilitate the program in collaboration with ... studies in change management literature and provides a model of change implementation in healthcare organizations, informed by the implementation of a major patient safety initiative at a large, ... Devereaux MW, Drynan AK, Lowry S, MacLennan D, Figdor M, Fancott C, Sinclair L: Evaluating organizational readiness for change: a preliminary mixed-model assessment of an interprofessional rehabilitation...
- 8
- 347
- 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case repor" ppt
... was placed in the anatomic position Part of the native head was used as a morselised autograft at the true acetabular bed The superolateral part of the head was used as a structural graft and secured ... technical difficulties of antegrade nailing due to the distorted anatomy and the limited ability of intraoperative traction and manipulation because of hip ankylosis in 15° of flexion and as a result ... 32 -A1 according to the AO-OTA classification [3] We performed a total hip arthroplasty via a posterolateral incision, using a long cementless Wagner stem [4] and a porous tantalum monoblock acetabular...
- 4
- 289
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25