0

depending on the number of effects in the chiller steam requirements of cooling can range from 4 5 kg kw to 8 3 kg kw moné et al 2001 a brewery in suita japan installed a

Báo cáo khoa học: An Escherichia coli twin-arginine signal peptide switches between helical and unstructured conformations depending on the hydrophobicity of the environment potx

Báo cáo khoa học: An Escherichia coli twin-arginine signal peptide switches between helical and unstructured conformations depending on the hydrophobicity of the environment potx

Báo cáo khoa học

... A (2001) Protein targeting by the twin-arginine translocation pathway Nat Rev Mol Cell Biol 2, 35 0 – 35 5 Dalbey, R.E & Kuhn, A (2000) Evolutionarily related insertion pathways of bacterial, mitochondrial, ... because a mutant version of the peptide containing twin-lysine contains almost exactly the same amount of a- helical structure This finding strongly suggests that the real significance of the twin-arginine ... conformation is generated either during entry into the interfacial region or after the initial interaction with the binding site Any form of typical binding site/groove probably also favours the...
  • 8
  • 330
  • 0
báo cáo hóa học:

báo cáo hóa học: " TLR3 signaling is either protective or pathogenic for the development of Theiler''''s virus-induced demyelinating disease depending on the time of viral infection" docx

Toán học

... (VP1), (5 TGACTAAGCAGGACTATGCCTTCC -3 and 5 -CAACGAGCCACATATGCGGATTAC -3 ); IL-1β, (5 -TCATGGGATGATAACCTGCT -3 and 5 -CCCATACTTTAGGAA- GACACGGAT -3 ); IFN-α, (5 -ACCTCCTCTGACCCAGGAAG -3 and 5 -GGCTCTCCAGACTTCTGCTC -3 ); ... Immunopharmacol 2011, 11:769-7 73 27 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 Pullen LC, Park SH, Miller SD, Dal Canto MC, Kim BS: Treatment with bacterial LPS renders genetically resistant C57BL/6 ... signaling during viral infection protects against demyelinating disease by reducing the viral load In contrast, premature activation of TLR3 signal transduction prior to viral infection may induce...
  • 42
  • 496
  • 0
Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx

Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx

Báo cáo khoa học

... CACCATCAATCAGACATTGCGCAAGGAAAGAAGTCC GGCCACTATCGATGCATCAGATG CATCTGATGCATCGATAGTGGCC GTGTTTGGGCCGAGTGGGAT GCCATTGATTCGTCCGACTA TCTAGAAAGCTTTTATACTTCCCGGGCAACACTATT GTCC TCTAGAAAGCTTTTAGTGATGGTGATGGTGATGGTG ... (exchanged bases underlined) Primer Sequence Sitea p1(f) GGTACCACTAGTGCCGCCACCATGGTTGTAAGAAT GATACGTCTTTGTAAAGG GCCGCCACCATGCAATCAGACATTGCGCAAGGAAA GAAGTCC GCCGCCACCATGCACCATCACCATCACCATCACCAT CACCATCAATCAGACATTGCGCAAGGAAAGAAGTCC ... TCTAGAAAGCTTTTAGTGATGGTGATGGTGATGGTG ATGCCGCCCTTCGATGCCGCCGCCGCCTACTTCCCGG GCAACACTATTGTCC GCCACTAGTTGGAGCCCTTCC GGCACTAGTATGCAATCAGACATTGCG CCATCAGGAAGCGGCGCATCAACAATTG CGTCTTTG CTTATTTTAGATCAAGCAACCAGTGCC CTATATCAATTGCAGCGAGGCTTTCGACG...
  • 13
  • 615
  • 0
gherghina et al - 2014 - a study on the relationship between cgr and company value - empirical evidence for s&p [cgs-iss]

gherghina et al - 2014 - a study on the relationship between cgr and company value - empirical evidence for s&p [cgs-iss]

Tổng hợp

... 20 14 Control variables Size 83 11.21 955 11.29 35 2 8 . 58 3 35 5 14. 50 86 6 1. 136 970 Leverage 83 0 .5 84 8 15 0 .57 50 38 0.1 35 5 13 1.20 34 6 9 0.171 633 GR 83 0 .47 41 84 0.272000 -0.6 189 00 9. 131 300 1.0 751 85 Listing 83 ... -0.0 35 7 25 -0. 036 130 -0. 03 68 74 -0.0 35 5 99 -0. 03 9 58 6 (-1 .46 86 71) (-1 .51 1 84 9 ) (-1 . 53 88 92) (-1 .49 956 8) (-1 .51 89 34 ) (-1 . 53 7 58 0) 83 43 .071 65* ** 0.71 952 2 83 42 . 980 39 *** 0.7190 84 83 43 .062 78* ** 0.71 9 48 0 83 ... 0.2 181 36 * 0.200771* 0.216160* 0. 188 016* (2 .42 4 088 ) (2 . 43 7 650 ) (2 .55 01 84 ) (2. 2 45 58 0) (2 .5 34 3 99) (2.0 147 93) N 83 83 83 83 83 83 F-statistic 2.979 037 * 2 .88 3 152 * 2 .80 881 3* 2 .86 33 67* 2 .82 7 1 48 * 1 .82 39 73 ...
  • 12
  • 497
  • 0
Báo cáo

Báo cáo " Mức độ thể hiện cảm xúc bản thân của trẻ em 4 -5 tuổi qua trò chơi đóng vai theo chủ đề ở trường mầm non " potx

Báo cáo khoa học

... 120 36 30 56 46 ,6 28 23 ,4 2,1 Tuc gian 120 30 25 45 37 ,5 45 37 .5 1.9 Buon dau 120 22 18, 3 51 42 .5 47 39 ,2 1 ,8 Qua ngon ngu' noi So hai I'uc gian Buon dau 120 120 120 37 53 45 30 .9 44 ,1 37 .4 55 47 ... 47 39 ,2 45 37 .5 1,9 Yeu thuong 120 25 20 ,8 59 49 .2 36 30 2,0 Ngae nhien 120 23 19.2 57 47 ,5 40 33 .3 1,9 120 19 15. 8 61 50 ,8 40 33 .3 1 ,8 Xgac nhien 120 16 13. 3 56 46 .7 48 40 1.7 Yeu thiro'ng Qua ... 1 .8 Vui mirng 120 33 27 .5 45 37 .5 42 35 1.9 Xgac nliien 120 16 13. 3 47 39 ,2 57 47 ,5 1.7 Yeu thucmg i'hdi gian thS hien 120 Yeu thuong Cudng the hien 120 34 28 .4 55 45 .8 31 25, 8 2,0 Trung binh...
  • 7
  • 1,514
  • 6
tiểu luận xây dựng và tổ chức các trò chơi học tập nhằm hình thành biểu tượng về thế giới động vật cho trẻ mẫu giáo nhì 4-5 tuổi trường mầm non hoa mai

tiểu luận xây dựng và tổ chức các trò chơi học tập nhằm hình thành biểu tượng về thế giới động vật cho trẻ mẫu giáo nhì 4-5 tuổi trường mầm non hoa mai

Kinh tế - Thương mại

... chức 18 thực 2.2 Xây dựng trò chơi học tập 19 KẾT LUẬN 29 KIẾN NGHỊ 30 TÀI LIỆU THAM KHẢO 31 Phụ lục I 32 Phụ lục II 34 Phụ lục III 35 Phụ lục IV 37 A PHẦN MỞ ĐẦU LÝ DO CHỌN ĐỀ TÀI: Trang / 39 BÀI ... mẫu giáo nhì trường mầm non Hoa Mai Khách thể đối tượng nghiên cứu 3. 1 Khách thể nghiờn cứu: Trang / 39 BÀI TẬP TỐT NGHIỆP 30 cháu trẻ 4- 5 tuổi trường mầm non Hoa Mai 3. 2 Đối tượng nghiên cứu: ... đến 20 /4/ 2006 s a ch a bổ sung hoàn thiện báo cáo Trang / 39 BÀI TẬP TỐT NGHIỆP Từ 20 /4 đến 30 /5/ 2006 s a ch a bổ sung in báo cáo theo mẫu B PHẦN NỘI DUNG Chương I CƠ SỞ Lí LUẬN THỰC TIỄN C A VIỆC...
  • 39
  • 6,799
  • 64
study on culture conditions of high phytase production from aspergillus fumigatus size 1415

study on culture conditions of high phytase production from aspergillus fumigatus size 1415

Tổng hợp

... yield of phytase was obtained at the concentration of 0 .5% (4. 490 U/g), it was remarkably higher than other malt extract concentration tested (0. 25 and 0. 75% ) and also higher at 0. 25% yeast extract ... 25( 6) :51 7 -52 1 Nair, V.C., J Laflamme and Z Duvnjak 1991 Production of phytase by Aspergillus ficuum and reduction of phytic acid 13 content in canola meal J Sci Food and Agri, 54 ( 3) : 35 5 3 65 Pasamontes, ... colorimetric determination of inorganic orthophosphate and its application to the assay of inorganic pyrophosphatase Anal Biochem, 1 13( 2) :31 3 -31 7 Jahnke, R .A 2000 The Phosphorus Cycle In Earth...
  • 19
  • 210
  • 0
Globalization and its effects on the development of educational service in Vietnam

Globalization and its effects on the development of educational service in Vietnam

Kinh tế - Quản lý

... 66 23 97 05 1 1 53 0 Capital Expenditure Regular expenditure 10 35 6 12 649 16906 186 25 2 7 83 0 35 0 07 45 59 5 55 240 600 600 710 970 1 250 1770 2970 3 38 0 41 5 49 5 7 25 9 25 13 05 23 28 233 3 90 National target program ... Kindergarten 17 International Kindergarten( America) 18 International school( Vietnam-America) 19 The Australian International Shool Saigon 20 Horizon International Bilingual Shool 21 APU( Amercia) ... Education and training for adapting new global value chains As analyzed, global value chains in Vietnam often base on cheap-salaried workers and varied other resources Participating into those chains,...
  • 63
  • 995
  • 3
AN ACTION RESEARCH ON THE EFFECTS OF PRE   WRITING ACTIVITIES ON THE GRADE – 11 NON – MAJOR ENGLISH STUDENTS’ MOTIVATION IN WRIT

AN ACTION RESEARCH ON THE EFFECTS OF PRE WRITING ACTIVITIES ON THE GRADE – 11 NON – MAJOR ENGLISH STUDENTS’ MOTIVATION IN WRIT

Khoa học xã hội

... creating and initiating a plan of action, as well as reflecting on the degree to which the plan work At another level, it can be about addressing educational practices that go beyond each teacher’s ... accounted for the psychological matter of the students They are, at that age, often talkative and naughty not only inside the classes 33 .33 % (5/ 15) of all the teachers admitted that their students ... questions and scaling Other sources of data come from writing tasks from the textbooks The analysis of the data hopefully will bring about reliable findings useful for the teaching of writing to non...
  • 58
  • 868
  • 6
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx

Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx

Báo cáo khoa học

... essential for the inhibition of H2O2-induced activation of caspases-9 and -3 and apoptosis (A) The effects of HSP70 and its deletion mutant proteins on the activation of caspases-9 and -3 were analyzed ... pcDNA3.1-HSP70DPBD Sense of pcDNA3.1-HSP70DATP-BD Antisense of pcDNA3.1-HSP70DATP-BD AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG ... ATP-binding domain of HSP70 inhibits Smac release B Jiang et al mitochondrial protein, second mitochondria-derived activator of caspase (Smac, also known as DIABLO), is released into the cytosol...
  • 10
  • 726
  • 0
Báo cáo

Báo cáo " Assessing effects of the waterholding bioproduct Lipomycin M on the amount of effective water in the soil " ppt

Báo cáo khoa học

... 2 .8 22. 05 21 . 48 23 .55 23. 54 3. 0 23. 26 22.70 25. 87 24. 24 3. 2 24. 82 24. 29 27.22 25. 55 3. 7 34 . 92 34 . 88 37 .44 36 .56 4. 2 35 . 54 35 . 74 38 . 54 39 .86 79.00g, and CT3: 80 .25g) It can be seen the amount of ... CT2 CT3 0.6 2.09 1. 04 1.61 1.90 1.0 4. 29 3. 20 3. 84 3 .89 1 .5 12. 54 12 .50 12. 94 14. 23 2.0 15. 86 15. 14 16 .31 17.91 2 .5 18 .44 17 .59 18. 97 19. 75 Comparison of the percentages of water stored in the ... TN3 0.6 1.21 0 . 48 1 .41 1.0 3. 25 3 .42 3. 25 1 .5 12 .82 12 .36 9. 78 2.0 14. 64 14. 15 11.72 2 .5 15. 89 15. 52 13. 39 3. 2 Effects of Lipomycin M on the amount of effective water in soil samples cultivated...
  • 5
  • 403
  • 0
Báo cáo khoa học: Effects of sphingomyelin, cholesterol and zinc ions on the binding, insertion and aggregation of the amyloid Ab1)40 peptide in solid-supported lipid bilayers ppt

Báo cáo khoa học: Effects of sphingomyelin, cholesterol and zinc ions on the binding, insertion and aggregation of the amyloid Ab1)40 peptide in solid-supported lipid bilayers ppt

Báo cáo khoa học

... 1 .46 0 1 .52 0 1 .55 5 1 .44 5 1 . 45 0 1 .52 2 5. 0 5. 8 6.2 1. 34 0 1 .3 65 1 .42 0 1. 34 0 1 .3 65 1 .40 0 3. 0 3. 0 4. 7 Table Optical parameters of lipid and peptide layers after amyloid b1 )40 peptide (Ab) aggregation chol, ... 2791–2797 34 Salamon Z & Tollin G (2001) Plasmon resonance spectroscopy: probing molecular interactions at surfaces and interfaces Spectroscopy 15, 161–1 75 35 Salamon Z, Devanathan S, Alves I & Tollin ... FEBS Journal 2 73 (2006) 1 38 9 – 140 2 ª 2006 The Authors Journal compilation ª 2006 FEBS S Devanathan et al Factors affecting Ab binding in lipid bilayers Fig Binding and aggregation of Ab in a DOPC...
  • 14
  • 532
  • 0
báo cáo hóa học:

báo cáo hóa học: " e differential mediating effects of pain and depression on the physical and mental dimension of quality of life in Hong Kong Chinese adults" pptx

Hóa học - Dầu khí

... measure Pain 2000, 88 (3) :30 3 -3 08 Fielding R, Wong WS: The prevalence of chronic pain, fatigue, and insomnia in the general population of Hong Kong Final report to the Health, Welfare and Food Bureau, ... 257 (8) :44 4 - 45 2 Skarstein J, Aass N, Fossa SD, Skovlund E, Dahl AA: Anxiety and depression in cancer patients: relation between the Hospital Anxiety and Depression Scale and the European Organization ... Depression masquerading as a diabetic neuropathy JAMA 1 980 , 2 43 :1 147 -1 150 Gallemore JL, Wilson WP: The complaint of pain in the clinical setting of affective disorders Southern Medical Journal 1969,...
  • 6
  • 521
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Effects of attention on the control of locomotion in individuals with chronic low back pain" pdf

Điện - Điện tử

... coordination and the variability of trunk coordination and stride parameters Flexible adaptations in trunk coordination to, for instance, changes in walking velocity are considered a hallmark of ... processing of pain signals As a result, gait can proceed in a more fluent and automatic fashion This hypothesis is based on the notion that both acute and chronic pain have a strong attentional component, ... stability [1, 13] In addition, variability of gait parameters and overall gait consistency provide important insights into the organization of healthy and pathological gait [ 13, 20- 23] For Page of...
  • 8
  • 565
  • 0
báo cáo hóa học:

báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt

Hóa học - Dầu khí

... This response of the healthy older adults to walking in near darkness also parallels the effects of an attention demanding task on the gait of healthy young and older adults [ 35 , 36 ] When healthy ... (0.2 95) 35 . 5 ± 3. 2 (0.0 15) 5. 1 ± 2 .5 (0 .3 65) 84 . 2 ± 33 .5 (0.0 13) *P-values shown in parentheses are based on within group comparisons between near dark and normal lighting All measures of gait ... mental loading and gait variability in Parkinson's disease Journal of the American Geriatrics Society 20 04, 52 :S3-S3 Hausdorff JM, Balash J, Giladi N: Effects of cognitive challenge on gait variability...
  • 8
  • 415
  • 0
báo cáo hóa học:

báo cáo hóa học: " Effects of betaine on lipopolysaccharide-induced memory impairment in mice and the involvement of GABA transporter 2" doc

Toán học

... forward TCCAGGATGAGGACATGAGCAC GAACGTCACACACCAGCAGGTTA forward CCACTTCACAAGTCGGAGGCTTA GCAAGTGCATCATCGTTGTTCATAC forward GGAATGGAGACTGTCCCAGCA GTCATGAGCAAAGGCGCAGA forward TGCAGGTGATGCTGACAGAGG reverse ... ß-actin Sequence (5 -3 ) GTGTGCGACATACTCAAGCAGGA TGAAGTGGTAACCGCTCAGGTG forward CCATCTTGGGCTTCATGTCTCA CAGCTGGGACAAAGGCATCA forward ACCAGCTTACGGCCAACAGTG TGTCTATACGCAGCCAGGTTGTTC forward TCCAGGATGAGGACATGAGCAC ... Pharmacological Society (Folia Pharmacol Japon, 1992, 99: 35 A) ; the Interministerial Decree of May 25th, 1 987 (Ministry of Education, Japan) ; and the National Institutes of Health Guide for the...
  • 38
  • 456
  • 0
báo cáo hóa học:

báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf

Hóa học - Dầu khí

... 38 ( 2): 149 - 157 Lakka TA, Venalainen JM, Rauramaa R, Salonen R, Tuomilehto J, Salonen JT: Relation of leisure-time physical activity and cardiorespiratory fitness to the risk of acute myocardial infarction ... protein Am J Cardiol 20 04, 93( 2):221 -5 Pearson TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public ... health practice: A statement for healthcare professionals from the Centers for http://www.occup-med.com/content /3/ 1/7 34 35 36 37 38 39 40 41 42 Disease Control and Prevention and the American...
  • 10
  • 662
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The effects of hypertonic fluid administration on the gene expression of inflammatory mediators in circulating leucocytes in patients with septic shock: a preliminary study" pptx

Hóa học - Dầu khí

... J Trauma 2000, 48 : 38 8 -3 95 doi:10.1 186 /2110 - 58 20-1 -44 Cite this article as: van Haren et al. : The effects of hypertonic fluid administration on the gene expression of inflammatory mediators in ... solution was added and the sample incubated, shaking at 37 °C for 30 to digest any contaminating DNA A total of μl of Stop solution was added, heated, and shaken at 65 C for 10 minutes, with the samples ... cytokines and activation of transcription factors in lipopolysaccharide-administered rats Acta Anaesthesiol Scand 20 05, 49 :6 35 - 642 23 Yassen KA, Galley HF, Webster NR: Matrix metalloproteinase-9 concentrations...
  • 8
  • 515
  • 0

Xem thêm