debug and test embedded c program with the keilmvision3
Gián án Test yourself c, review for the first term
Ngày tải lên :
28/11/2013, 11:11
... their results with the other groups, and correct Keys: F, F, T, T, F - Listen to the teacher - Work in groups to complete the sentences - Compare the results with the other groups - Correct mistakes ... rewrite and correct - Give remarks on the changes of reported speech - Listen to the teacher's explaining and note down - Listen and write down the rules - rewrite and correct the sentences - Give ... note down - Listen and write down the rules - rewrite and correct the sentences - Give remarks on the changes of reported speech 3, Command and request - Listen to the teacher's S + told/asked/ordered/reminded/warned...
- 15
- 917
- 0
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx
Ngày tải lên :
14/03/2014, 23:20
... that workouts before tackling fat loss But an the chapter called Get Big focuses on muscle experienced lifter could start there, and then hypertrophy, and that the subsequent chapter, move on to ... in these first weeks is to focus on the speed of your lifts in conjunction with your form All of the parameters will remain constant except for the load you use for each exercise The reason the ... mix of ent muscles at once, which is why they build single-joint and compound exercises for your size and strength so quickly and dependably, triceps and why I use them almost exclusively in my...
- 112
- 530
- 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_3 pot
Ngày tải lên :
14/03/2014, 23:20
... use the squat rack, you can start with the bar on the floor in front of the bench Stand and clean the bar to your shoulders, then sit on the bench (The clean and power clean are described and ... you to a choice of either high or low), set them at shoulder height Grab one handle with each hand and pull them to the sides of your chest Stand between the stacks, and split your stance (one ... the machine, with the goal of working with your own body weight as soon as possible Without access to that machine, you can use an advanced technique called rest-pause , which I describe in Chapter...
- 98
- 452
- 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_4 pptx
Ngày tải lên :
22/03/2014, 16:21
... guidelines, 119 Concentric muscle contraction, 32 Conjugated linoleic acid (CLA), 327 Cooldown, flexibility exercises for calves (soleus) stretch, 83, 83 chest stretch, 85, 85 front shoulder stretch, 84, ... stretch, 87, 87 Core muscle exercises See also specific muscles camel/cat, 73, 73 Cortisol, 310 Cottage cheese, 314, 316, 321 , 324 Cravings, 325, 326 Creatine phosphate system, H , 322 Crunch ... gestible chemicals called sugar alcohols to cut too far from the recommendations in this down on their carbohydrate count, and protein chapter And, most of all, don't count total powders often include...
- 57
- 391
- 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_1 doc
Ngày tải lên :
22/03/2014, 16:21
... lengthening That by the performance-enhancing possibilities of means it also recruits fewer motor units for eccentrics that they came up with two basic eccentrics, since it always recruits them ... combination of compound and isolation exercises, with the compound exercises focusing on the biggest muscles and the isolation exercises targeting the smaller ones? My response: Because you can ... vertical circles because of the soreness it induces, since jump or the amount of weight you can pull on 33 THEBRAINS a deadlift The swelling might make them lowering contest In that case, eccentrics...
- 103
- 552
- 2
Báo cáo khóa học: Structural and functional comparison of 15S- and 15R-specific cyclooxygenases from the coral Plexaura homomalla potx
Ngày tải lên :
23/03/2014, 12:20
... the 15S-COX and an Ile349Val mutant of the 15R-COX were prepared and expressed in the baculovirus system The mutants were incubated with [1-1 4C] arachidonic acid in the presence of SnCl2 and the ... ORF of 1776 nucleotides corresponding to 592 amino acids The deduced amino acid sequence of novel COX is 97% identical with the COX sequence from the same coral species collected in the Florida ... (Eur J Biochem 271) characterize the COX enzyme from the S-variety of P homomalla, compare its primary structure and catalytic properties with its 15R-speci c counterpart, and locate the residues...
- 6
- 414
- 0
embedded signal processing with the micro signal architecture
Ngày tải lên :
01/06/2014, 08:03
... 1.15 Click OK to apply changes to the project options To add the source files to the new project, click on Project Æ Add to Project Æ File(s) Select the two source files and click Add The sources ... between the C function code in Experiment 1.1 and the assembly function code listed in this exercise Benchmark and compare the cycle count for performing the same dot product with assembly code with ... the program by clicking on File Æ Reload Program The program pointer will reset to the beginning of the program In the Cycle window, clear the CYCLE register value to to initialize the cycle counter...
- 507
- 223
- 0
báo cáo hóa học: " Increased circulating leukocyte numbers and altered macrophage phenotype correlate with the altered immune response to brain injury in metallothionein (MT) -I/II null mutant mice" doc
Ngày tải lên :
19/06/2014, 22:20
... TCTGTGGTGTTCTTCGTTGC ACAATTTAGGAGGTGCCGTG Rev MT-I Fwd NM_021283.2 CCAGCTGGTACAGCAGACAA Fwd GCTGTCCTCTAAGCGTCACC Rev MT-II NM_008337.3 NM_009892.2 AGGAGCAGCAGCTCTTCTTG Fwd CAAACCGATCTCTCGTCGAT Rev AGGAGCAGCAGCTTTTCTTG ... GGATGCAGGGATGATGTTCT Fwd ACTGGCAAAAGGATGGTGAC GACCTGTGGGTTGTTGACCT Fwd TCAACCCCCAGCTAGTTGTC Rev IL-4 Accession No CCCAGAAGACTGTGGATGG Rev IFN-g Sequence (5’ - 3’) Fwd Rev GAPDH TCTGTGGTGTTCTTCGTTGC ... reduced capacity for zinc sequestration to the liver, a process that occurs at DPI in wild type mice (Pankhurst et al., manuscript submitted) The co-occurrence of this event with many of the...
- 11
- 460
- 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
Ngày tải lên :
20/06/2014, 15:20
... of confidentiality, and gave informed consent to participate The patients were recruited consecutively in the cancer service, the multiple sclerosis service, and two internal medical units of the ... humanistic practice nature-oriented practice R+S+ individuals conventional religious practice existentialistic practice unconventional spiritual practice humanistic practice nature-oriented practice R+S- ... existentialistic practice unconventional spiritual practice humanistic practice nature-oriented practice R-S- individuals conventional religious practice existentialistic practice unconventional...
- 11
- 425
- 0
Báo cáo khoa học: "Successful treatment of perineal necrotising fasciitis and associated pubic bone osteomyelitis with the vacuum assisted closure system" ppsx
Ngày tải lên :
09/08/2014, 07:21
... haemolytic streptococci and staphylococcus aureus; gram-negative enterobacteriaceae, escherichia coli, klebsiella spp and proteus spp; anaerobes including peptostreptococcus, clostridia and bacteroides; ... antibiotics Bacteriological culture from our case grew a mixture of microbes including streptococci, staphylococci, enterococci and anaerobes It is important for early clinical assessment to detect ... hypoaesthesia, fluctuance and induration [2] Further deterioration results in haemorrhagic bullae, dermal necrosis, gangrene combined with systemic complications such as hyperpyrexia and septic shock...
- 4
- 304
- 1
Báo cáo y học: " Sociodemographic and occupational risk factors associated with the development of different burnout types: the cross-sectional University of Zaragoza study" docx
Ngày tải lên :
11/08/2014, 15:22
... MG and FM conceived the project JMM and JMC collected the data JMM, MFP and SG conducted the statistical analysis, and all authors interpreted the results, drafted the manuscript and read and ... subjects’ sociodemographic and occupational features, Page of 13 using percentages to summarise the categorical variables and the c2 contrast test to assess differences in percentages Means, standard ... suggests the existence of associations between the different burnout subtypes (classified according to the degree of dedication to work) and the different sociodemographic and occupational characteristics...
- 13
- 448
- 0
Báo cáo y học: "Association of acid phosphatase locus 1*C allele with the risk of" doc
Ngày tải lên :
12/08/2014, 17:22
... Standard error Anti-CCP antibodies, anti-cyclic citrullinated peptide antibodies cerebrovascular accident or peripheral artheriopathy Clinical definitions for CV events and classic CV risk factors ... (CI), according to Woolf’s methods The same procedure was applied in the subgroups stratified according to the presence or absence of anti-cyclic citrullinated peptide antibodies (ACPA) Association ... 2) In contrast, ACP1*A allele (CG), which was the opposite allelic combination of ACP *C, showed a trend for Table Differences between RA patients with and without CV events according to ACP1 polymorphisms...
- 6
- 250
- 0
Markoff maps and SL(2,C) characters with one rational end invariant
Ngày tải lên :
16/10/2015, 15:35
... 01 and hence, a +c connected to ∞ by a vertical straight line As the inductive step, we obtain b+d a c from the existing Farey neighbours and b d a +c a c Now lies in between and and is the common ... acts many times, its loci can be sufficiently close to any point on the circumference Proof Since we only concern about the angular motion, without loss of generality, we may assume the circumference ... correspondence with Q ∪ {∞} Here by essential we mean the curve is homotopic to neither the trivial curve nor the boundary of T We just consider the slope of these homotopy classes Since each...
- 46
- 228
- 0
RENORMALIZATION GROUP AND 3 3 1 MODEL WITH THE DISCRETE FLAVOUR SYMMETRIES
Ngày tải lên :
30/10/2015, 19:51
... A4 for φ and s are discarded and understood III.2 Calculation of bi With the above particle content, we have (1) For the group SU (3 )C : bA4 = C where ng is the number of families, and is taken ... respectively (these will be derived from the potential minimization conditions) Here and after, the number subscripts on the component scalar fields are indices of SU(3)L The S4 indices are discarded and ... The MU scale, where all the well-normalized couplings have the same value, can be calculated from (2) and (3) as a function of the symmetry breaking scale MX M U = MX MX MZ bs −b2L 3C −b3L −b...
- 6
- 379
- 0
Practical embedded controllers design and troubleshooting with the motorola 68HC11
Ngày tải lên :
12/12/2013, 21:28
... stabilize the clocking in microcontroller oscillators The selection of the frequency of the crystal determines the speed of the microcontroller and also the baud rate of the communications The crystal ... static is introduced into a microcontroller, the program counter can become garbled The program counter points to the next instruction in the program If the program counter becomes mixed up, the program ... ultimately understand the microcontroller and embedded controller The central processor unit (CPU) is the brain of the microcontroller The CPU controls all functions and uses the program that resides...
- 266
- 494
- 2
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
Ngày tải lên :
07/03/2014, 10:20
... PCR using speci c primer sets, namely, Hi_pDEDF (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), ... CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and TATGTCTTT (P 9C) , were also synthesized chemically The underlined sequences are changes from the original ... sequence of the caspase-1 gene was introduced using speci c primers (forward, 5¢-CCTGATGCAGGCTA CAGTTCT-3¢; and reverse, 5¢-GCATATGCATGTATT TATTTTTCTTC-3¢) and standard procedures The speci c mutation...
- 14
- 393
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
Ngày tải lên :
08/03/2014, 08:20
... synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG ... C and the supernatants were removed and stored at )20 C For fractionation into nuclear and cytosolic extracts the cells were rinsed once with ice-cold NaCl/Pi, scraped off the dish in mL NaCl/Pi ... hypodermic needle and the extract was centrifuged for with 14 000 r.p.m at C (Eppendorf centrifuge 5417R) The supernatant containing the cytosolic fraction was collected and kept on ice The nuclear...
- 16
- 754
- 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
Ngày tải lên :
15/03/2014, 00:20
... are denoted T and CT, respectively The protonated monoisotopic experimental masses (MH+exp) and the calculated mass difference (p.p.m.) with the theoretical monoisotopic mass of the identified ... given The presence of the modified peptides in the Ure2p, Ssa1p and Ure2p–Ssa1p complexes with apparent molecular masses 160 and 120 kDa tryptic and chymotryptic reaction products is indicated ... following the incubation under agitation 5120 of the reaction products with 5% formic acid at 37 C for 15 The extracted peptides were vacuum dried, dissolved in 1% formic acid and stored at )20 C until...
- 12
- 510
- 0
Báo cáo khoa học: Treatment with small interfering RNA affects the microRNA pathway and causes unspecific defects in zebrafish embryos doc
Ngày tải lên :
16/03/2014, 06:20
... BIO-GUACCC CAACUUGAUAGCACUUU; miR-206, BIO-CCACATG CTTCCTTATATTCCATA; miR-17a-1, BIO-ACTACCTG CACTGTAAGCACTTTG; miR-19b, BIO-TCAGTTTT GCATGGATTTGCACA miR-206 duplex: AAUGUAA GGAAGUGUGUGGGU; CCACACACUUCCUUACAA ... siEri1, UCAGUGAUCCGGUGUAUAA(TT); siSix3a, CUAUCA GGAGGCCGAGAAA(TT); siGFP, AAGCUGACCCU GAAGUUCA(TT); dsGFP, AAGCUGACCCUGAAGU UCA; sGFP, AAGCUGACCCUGAAGUUCA(TT); asGFP, UGAACUUCAGGGUCAGCUU(TT) Northern ... GGAAGUGUGUGGGU; CCACACACUUCCUUACAA UUU miR-430b duplex: AAAGUGCUAUCAAGUUGGG GU; CCCAACUUGAUAGCACUAUUU miR-430b-mis duplex, as described in [23]: AAAGACCUAUCAAG UUGGGGT; CCCAACUUGAUAGGUCUAUTT Northern blot analysis...
- 8
- 304
- 0