0

dates numbers and currency exam objective 3 4

scjp sun certified aprogrammer for java platform 6th ed

scjp sun certified aprogrammer for java platform 6th ed

Kỹ thuật lập trình

... Lists Searching Lists 42 5 42 6 42 6 43 2 43 3 43 6 43 6 43 8 44 1 44 5 44 9 45 0 45 1 4 53 45 5 45 8 46 1 46 1 46 7 Contents xvi Working with Arrays Sorting Arrays Searching Arrays Summary Exam Essentials Review ... Waiting and Timed-Waiting Threads Terminated Threads Thread Synchronization The Monitor Lock The wait, notify, and notifyAll Methods Summary 34 2 34 3 34 4 34 6 34 9 34 9 35 1 35 3 35 3 35 5 35 5 35 8 36 3 36 8 ... Answers to Review Questions Chapter 281 281 2 83 285 285 287 289 291 2 94 295 298 30 1 30 1 30 3 30 4 30 6 30 6 31 2 31 5 31 5 32 0 32 2 32 4 32 5 32 6 33 7 Concurrency 34 1 Overview of Threads Writing a Thread Implementing...
  • 583
  • 330
  • 0
Báo cáo y học:

Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

Y học thưởng thức

... Positive 23 / 32 0 44 35 23 21 37 / 640 18 13 16 17 1 / 1280 / 2560 37 14 18 11 19 27 12 10 30 13 1 / 5120 21 19 18 20 1 / 10 240 10 8 1 23 77 122 78 159 41 Immuncapture Number of Positive sample 144 Negative ... calcu- 43 1 lated to be 97.1 % for ELISA Ig G and 71 .4 % for ELISA Ig M They found the compatibility of ELISA Ig M and Ig G test results with STA at the level of 75 .3 % for Ig M and 84. 4 % for ... predictive and positive predictive values were found to be 90,6 %, 76 ,3 %, 94, 2 %, and 65,9 % respectively for the Immuncapture test, whereas they were found to be 73, 7 %, 58,9 %, 84, 2 %, and 42 ,8...
  • 5
  • 604
  • 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Môi trường

... 518.8 0.08 10.0 0. 53 0. 64 109 .3 9.1 505 .3 522.2 0.08 9.8 3. 6 3. 4 3. 1 4. 2 3. 6 5.0 6.0 2.6 2.6 44 .71 44 .85 44 .88 44 . 83 45 .29 46 .32 43 . 16 43 . 52 930 6750 236 5 828 1950 46 54 547 40 00 EIS, Alternative ... 6.1 0. 74 0.75 119.8 10.0 519.0 519.0 0.08 9.9 0. 53 0.71 108.2 9 .4 519.9 522.2 0.08 9 .3 5.0 3. 4 5.0 5.0 3. 6 2.7 5.6 3. 1 3. 9 44 . 64 44. 98 44 . 73 44 .68 44 .98 45 .80 43 . 01 43 . 46 7 23 540 0 1 241 45 5 2700 ... 0.08 9.1 3. 6 519.0 519.0 0.08 9.9 3. 1 518.8 518.8 0.08 9.2 3. 4 518.8 5 14. 0 0.08 9.0 3. 6 520.8 518.8 0.08 10.0 2.6 OF (US$/MWh) 44 . 64 7 23 NC 44 .68 45 5 43 . 01 47 5 44 .71 930 44 . 83 828 43 . 16 547 o S08.t...
  • 14
  • 593
  • 0
Tài liệu Bài 3: Gradients and Optimization Methods ppt

Tài liệu Bài 3: Gradients and Optimization Methods ppt

Ngân hàng - Tín dụng

... x x w X =1 X2 (t) = (3. 35) (t) < (3. 36) t =1 t wx and the nonlinearity g ( ) satisfies some technical assumptions [2 53] , then it can be shown that the on-line algorithm (3. 32) must converge to ... with nonlinear optimization, for example, [46 , 135 , 2 84] , and their applications [172, 40 7] The speed of convergence of the algorithms is discussed in [2 84, 40 7] A good source for matrix gradients ... changes, and adapt quickly to the changing environment Example 3. 6 In Chapter 6, on-line PCA is discussed One of the learning rules is as follows: w / xy wx y2 w (3. 37) x where y = T and is a random...
  • 20
  • 408
  • 0
Tài liệu Part III: EXTENSIONS AND RELATED METHODS pdf

Tài liệu Part III: EXTENSIONS AND RELATED METHODS pdf

Hóa học - Dầu khí

... rinen, Juha Karhunen, Erkki Oja a Copyright  2001 John Wiley & Sons, Inc ISBNs: 0 -47 1 -40 540 -X (Hardback); 0 -47 1-22 131 -7 (Electronic) 15 Noisy ICA In real life, there is always some kind of noise ... performing ICA For example, simple filtering of time-signals is often very useful in this respect, and so is dimension reduction by principal component analysis (PCA); see Sections 13. 1.2 and 13. 2.2 In ... assumption, standard in factor analysis and signal processing, and allows for a simple formulation of the noisy model Thus, the noisy ICA model can be expressed as x = As + n (15.1) 2 93 2 94 NOISY ICA...
  • 13
  • 379
  • 0
PID ALGORITHM  AND TUNNING METHODS

PID ALGORITHM AND TUNNING METHODS

Cao đẳng - Đại học

... elements: • Proportional only Proportional and Integral (most common) • Proportional, Integral, and Derivative • Proportional and Derivative • We will examine each of the three elements below: ... between the setpoint, the measurement, and the output Proportional—units The proportional or gain term may be calibrated in two ways: Gain and Proportional Band Gain = Output/Input Increasing the ... proportional and integral only Calculation of repeat time: (gain and reset terms used in controller) With the error set to zero (measurement input = setpoint), make a change in the input and note...
  • 40
  • 491
  • 0
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf

Cao đẳng - Đại học

... analysis Logic is common ground on which the partisans of Hartley and of Reid, of Locke and of Kant, may meet and join hands Particular and detached opinions of all these thinkers will no doubt occasionally ... soldier, and Thompson is a soldier, and Smith is a soldier, but we can not say, Jones is the 76th regiment, and Thompson is the 76th regiment, and Smith is the 76th regiment We can only say, Jones, and ... from us, and partly of a comparison (made with so much rapidity that we are unconscious of making it) between the size and color of the object as they appear at the time, and the size and color...
  • 1,048
  • 548
  • 0
Prenatal Diagnosis – Morphology Scan and Invasive Methods Edited by Richard Kwong Wai Choy and Tak Yeung Leung docx

Prenatal Diagnosis – Morphology Scan and Invasive Methods Edited by Richard Kwong Wai Choy and Tak Yeung Leung docx

Cao đẳng - Đại học

... vol. 14, No .4, (April 2000),pp.7 237 30 Kay,H.;Nelson,M.;Wang Y.(2011).Cordocentesis and fetoscopy.In:The placenta:from development to disease.Kay,H,pp. 147 , Blackwell publication;ISBN:978-1 -4 43 3 -33 6 64; UK ... Gynecol,vol.191,No.5,(May 20 04) ,pp.2 035 Brun,JL.;Mangione,R.;Gangbo,F.(20 03) Feasibility,accuracy and safety of chorionic villus sampling:a report of 10 741 cases.Prenatal Diagnosis,vol. 23, No .4, (April 20 03) ,pp.29 530 1 ... Elias,S.;Emerson,DS.;Simpson,JL.(19 94) .Ultrasound-guided fetal skin sampling for prenatal diagnosis of genodermatoses Obstet Gynecol, vo. 83, No .4, (April 19 94) ,pp .33 7 - 34 1 Elias,S.;Simpson,JL.(19 93) .Amniocentesis.In:Essentials...
  • 220
  • 1,087
  • 0
POULTRY RATIONS and Feeding Methods ppt

POULTRY RATIONS and Feeding Methods ppt

Nông nghiệp

... shell or bone, and in preventing leg weakness and rickets (3) Riboflavin (in milk, liver, yeast, green feed, synthetic riboflavin, etc.) Riboflavin promotes the growth of chicks and poults, both ... winter laying rations and in rations for producing eggs for hatching, as a source of Vitamins A and D when the supply of green pasture and direct sunshine is limited or lacking Standard fish oils ... amount of mash and grain consumed, and allows one to use a cheap and simple growing ration Good pasture helps to grow sleek smoothlyfeathered vigorous pullets, enabling them to withstand the strain...
  • 12
  • 617
  • 1
International Macroeconomics and Finance: Theory and Empirical Methods pptx

International Macroeconomics and Finance: Theory and Empirical Methods pptx

Ngân hàng - Tín dụng

... 03/ 17/99 FT k ST k 0. 7 34 6 0.6 942 0.772 0.72 63 0.7507 0.71 63 0.7 147 0.6859 0.7860 0.7582 0.8 948 0.8661 0. 849 8 0.8 244 0.8815 0.8596 0.8976 0.8790 0.85 24 0. 840 1 0.8575 0. 84 63 FT k 0.0000 0. 037 4 ... 0. 037 4 -0.02 13 -0. 036 0 0.07 13 0.1088 -0. 045 0 0. 031 7 0.0161 -0. 045 2 0.0051 Long yen position (FT k VT ) Margin 0.0 2 835 .0 46 75.0 7510.0 -2662.5 48 47.5 -45 00.0 34 7.5 8912.5 9260.0 136 00.0 22860.0 ... 136 00.0 22860.0 -5625.0 17 235 .0 39 62.5 21197.5 2012.5 232 10.0 -5650.0 17560.0 637 .5 18197.5 T k 1.0581 1.0628 1. 047 9 1. 041 8 1. 036 5 1. 033 0 1. 030 8 1.02 54 1.0211 1.0 146 1.0 131 on the futures contract...
  • 376
  • 776
  • 0
Software Cost Estimation and Sizing Methods - Issues and Guidelines pptx

Software Cost Estimation and Sizing Methods - Issues and Guidelines pptx

Cao đẳng - Đại học

... 23 Lines of Code 24 Function Points and Feature Points 27 Object Points 31 Application Points 33 Predictive Object Points 34 Analogies 37 Estimating ... Points 28 3. 3 Transforming Characteristics into Object Points 31 3. 4 Using Analogies to Generate a Size Estimate 38 3. 5 Generating a Size Estimate from Use Cases 40 4. 1 Relationships ... Tables 3. 1 Initial Function-Point Count 28 3. 2 Object-Point Calculation 33 3. 3 Application Points 34 xiii Executive Summary Introduction (see pp 1–7) Estimating the size and cost...
  • 127
  • 326
  • 0
Building Plans for Poultrymen and Practical Methods of Poultry Raising doc

Building Plans for Poultrymen and Practical Methods of Poultry Raising doc

Nông nghiệp

... task a recreation for the other and to come away from the city and office with its cares and intense mental exertion and hurry out to the poultry headquarters and attend to a nice flock of busy ... condition and health the fowls must be fed right, housed right and not crowded If your fowls seem out of condition, give them more park and house room Give plenty of sunshine and fresh air and water ... FOR POULTRYMEN 14 sell me his $40 house for $20 and song, as he was greatly disgusted with the "chicken business." and his whole trouble was in attempting too much, overcrowding, and failure to...
  • 132
  • 364
  • 0
an introduction to programming and numerical methods in matlab - s.r. otto & j.p. denier

an introduction to programming and numerical methods in matlab - s.r. otto & j.p. denier

Điện - Điện tử

... 0 .33 33 3. 141 6 1 .41 42 >> format long; s s = 0.50000000000000 0 .33 333 333 333 333 3. 141 5926 535 8979 >> format rat; s s = 1/2 1 /3 355/1 13 >> format ; s s = 0.5000 0 .33 33 3. 141 6 1 .41 42 139 3/985 1 .41 42 135 6 237 310 ... given by 1+2 /3* 4- 5 = + − = − , 3 , 1/2 /3/ 4 = (((1/2) /3) /4) = 24 17 1/2 +3/ 4* 5 = + = , 4 5-2 *3* (2+7) = − 6(9) = 49 , 16 × (−1) 4= − , 3 4 (2 -3* (4 -3) ) *4/ 5 = (2 − × 1) = − ; 5 (1 +3) *(2 -3) /3* 4 = which ... for the expression to make sense Example 1 .4 Evaluate the MATLAB expressions 1+2 /3* 4- 5 1/2 /3/ 4 1/2 +3/ 4* 5 5-2 *3* (2+7) (1 +3) *(2 -3) /3* 4 (2 -3* (4 -3) ) *4/ 5 by hand and then check answers with MATLAB...
  • 468
  • 601
  • 0
cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks

cell cycle control mechanisms and protocols methods in molecular biology - tim humphrey, gavin brooks

Sinh học

... containing CDC27 and CDC16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B Cell 81, 279–288 44 44 45 45 46 46 47 47 48 48 49 49 50 50 51 51 52 52 53 53 54 54 55 55 56 56 57 ... Rev Biochem 34 71, 33 3 37 4 35 Doerner, P., Jorgensen, J E., You, R., Steppuhn, J., and Lamb, C (1996) Control of root 35 growth and development by cyclin expression Nature 38 0, 520–5 23 36 Wyrzykowska, ... 667–676 82 82 83 83 84 84 85 85 86 86 87 87 88 88 89 89 90 90 91 91 92 92 93 93 94 94 95 95 96 96 97 97 The Budding and Fission Yeasts 98 98 99 99 100 100 101 101 102 102 1 03 1 03 1 04 1 04 105 105 106...
  • 409
  • 876
  • 0
directed enzyme evolution, screening and selection methods

directed enzyme evolution, screening and selection methods

Sinh học

... 748 756 758 (–11 to –8) Round R3 – R3 – 32 R3 – 26 R3 – 17 R3 – R3 – 29 Asn Asn Asn Ala Phe Thr Arg Arg Arg Met Gly Lys Cys Cys Cys Ser Ile Gln GACT GACG TGTA GGTA GCTA GACT Round R4 – 14 R4 ... dish turntable, 10 µL inoculation loop, and ethanol for flaming 12 Bunsen burner 13 30 and 37 °C incubators 14 30 °C shakers 14 Camps and Loeb Methods Combine 40 µL (5 × 109 cells) competent cells ... used and the minimum prerequisites are sensitivity to canavanine and auxotrophy for Leu2, Ura3, and/ or Trp1, His3, Lys2 markers We used YGL27-3D (MATa, leu2 his3 trp1 lys2 ura3 CAN1, pol3::KanMX)...
  • 361
  • 263
  • 0
telomeres and telomerase, methods and protocols

telomeres and telomerase, methods and protocols

Sinh học

... 24 polymorhisms for 14 proterminal regions Genomics 36 , 49 2 – 506 33 Meltzer, P S., Guan, X Y., and Trent, J M (19 93) Telomere capture stabilizes chromosome breakage Nat Genet 4, 252 – 255 34 ... normal cells Science 279, 34 9 – 35 2 47 Bacchetti, S (1996) Telomere dynamics and telomerase activity in cell senescence and cancer Cell Dev Biol 7, 31 39 48 Shay, J W and Bacchetti, S (1997) A ... normal cells Science 279, 34 9 – 35 2 47 Bacchetti, S (1996) Telomere dynamics and telomerase activity in cell senescence and cancer Cell Dev Biol 7, 31 39 48 Shay, J W and Bacchetti, S (1997) A...
  • 236
  • 344
  • 0
hplc of peptides and proteins, methods and protocols

hplc of peptides and proteins, methods and protocols

Sinh học

... 2 .4 3. 4 3. 13 2.6 3. 6 3. 81 3. 6 4 .3 3.75 3. 8 4 .3 4. 21 4 .3 4. 8 4. 76 4. 8–5.2 5.68 5.0–6.0 7.20 6.7–7.6 7.55 7.6–8.2 8 .35 8.2–8.7 Anion exchange 4. 75 4. 5–5.0 5.68 5.0–6.0 5.96 5.5–6.0 6 .46 5.8–6 .4 ... Silica 10 15 30 24 44 45 –165 40 –125 10 2.5 25 50 8,10 8,10 – – – – – – – 1000 – 725 1000 1000 40 00 30 0 140 –180 16 30 na na 140 –200 180–250 90 30 0 na 110 30 160 40 na na na – – – – – – – 40 (hemoglobin) ... http://www.sigmaaldrich.com Polymerlabs: http://polymerlabs.com CH 03, 23- 44 ,22pgs 10 /30 / 03 6:58 PM Page 44 CH 04, 45- 54, 10pgs 10 /30 / 03 7:02 PM Page 45 High-Performance Hydrophobic Interaction Chromatography...
  • 395
  • 367
  • 0
mrna processing and metabolism, methods and protocols

mrna processing and metabolism, methods and protocols

Sinh học

... Dev 15, 33 19 33 29 16 Morris, D P., Phatnani, H., and Greenleaf, A L (1999) Phospho-CTD binding and the role of a prolyl isomerase in pre-mRNA 3' end formation J Biol Chem 2 74, 31 ,5 83 31 ,587 17 ... CCCAACTGAAGGCTAGGCTGTGG PMA1 p, 37 0 PMA1 p, –70 PMA1 cds1, +168 PMA1 cds1, +37 6 PMA1 cds2, +1010 PMA1 cds2, +1 235 PMA1 cds3, +2018 PMA1 cds3, +2290 PMA1 cds4, +5 84 PMA1 cds4, +807 PMA1 3' UTR top PMA1 3' UTR bottom ... Drosophila melanogaster Mol Cell Biol 7, 33 41 33 44 10 Dedon, P C., Soults, J A., Allis, C D., and Gorovsky, M A (1991) A simplified formaldehyde fixation and immunoprecipitation technique for studying...
  • 267
  • 340
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25