d 120 a env recombinants and mapping recombination breakpoints

Báo cáo y học: "Enrichment of intersubtype HIV-1 recombinants in a dual infection system using HIV-1 strain-specific siRNAs" pps

Báo cáo y học: "Enrichment of intersubtype HIV-1 recombinants in a dual infection system using HIV-1 strain-specific siRNAs" pps

Ngày tải lên : 13/08/2014, 01:20
... ether-protected, desalted and duplexed oligonucleotides by Dharmacon (Lafayette, Colo.) Six siRNAs (siRNA12 0a, siRNA120b, siRNA120c, siRNA12 0d, siRNA12 6a, and siRNA126b) were designed according to ... siRNA12 0a and siRNA12 6a treatment will only enrich those recombinants containing upstream env (C1) of v126 -D and downstream env (gp41) of v120 -A, which can escape siRNA targeting and degradation ... helped with analysis of recombinants and determination of breakpoints DM and AA helped with virus propagation assay EJA provided overall supervision for the project, secured funding, and helped...
  • 12
  • 250
  • 0
The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

Ngày tải lên : 23/09/2012, 14:47
... includes the exchangeable and carbonate fractions in our research Like Cu, Zn was not greatly fixed on sandstone oxyhydroxydes and clay (Duquet and V6dy, 1991), and similarly Zn in the residual ... plant available Pb was dramatically decreased The finding is similar to that of Garcia et al ,(1990) who extracted more plant available metals by DTPA after composting of aerobic digested sludge ... significantly reduced, because the leachability and plant availability of metals can be expressed as the exchangeable, carbonates and oxides bound metal species (see below) Zn Zn in the sludge and sludge...
  • 14
  • 1K
  • 0
Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc

Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc

Ngày tải lên : 17/02/2014, 03:20
... the standard CAPM to its static nature; see, for example, Hansen and Richard [1987], Jagannathan and Wang [1996], and Gomes et al [2003] More recently, Avramov and Chordia [2006] show that allowing ... low-yielding savings and transaction deposits We find that this so-called deposit disintermediation is especially pronounced for large banks and institutions that rely heavily on demand and transaction ... repricing/maturity gap to increase by one standard deviation (1.7 years) In contrast, greater dependence on savings or demand and transaction deposits is associated with a bigger market beta, implying a...
  • 47
  • 528
  • 1
Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

Tài liệu Báo cáo khoa học: Insights into the structure of plant a-type phospholipase D Susanne Stumpe, Stephan Konig and Renate Ulbrich-Hofmann ¨ ppt

Ngày tải lên : 19/02/2014, 02:20
... PLDa2 (250– 300 nm, Fig 4D) , describing the chiral environment of the aromatic amino acid side chains, has a defined structure that presents two sharp minima at 288 and 295 nm, and two maxima at ... of a plant a- type PLD has been obtained on the basis of recombinantly produced PLDa2 from cabbage SAXS analysis (Fig 2) and analytic size exclusion chromatography indicate unequivocally that native ... (w ⁄ v) acrylamide] were stained with Coomassie Brilliant Blue G250 and quantified by densitometric evaluation at 595 nm (CD60; Desaga, Darmstadt, Germany) Small angle X-ray solution scattering...
  • 11
  • 750
  • 0
Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

Ngày tải lên : 07/03/2014, 12:20
... A. A.N N-QRIN LQ GG IFW AGAD ASDA.NS.VS D. D 113 Triticum G .A. S N-QRIN LQ GG IFW AGAD AADA.NA.VG D. D 113 Zea AYA.S A- QRQG LI GG FW AGAD.SASDA.GS.VS QY.DHDT.S 112 Nicotiana AYA.N S-Q.AA NL HGQ AE ... the glycopeptide with a signal at m ⁄ z 1608.7 obtained by PSD analysis amidase-F and glycoamidase -A were permethylated and subjected to MALDI MS and MS ⁄ MS analyses, taking advantage of the enzyme’s ... contained a major signal at m ⁄ z 1816.8 and the second was dominated by two major signals at m ⁄ z 2646.4 and 2668.4, the mass interval of which indicated a protonated and sodiated molecular...
  • 10
  • 665
  • 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Ngày tải lên : 17/03/2014, 10:20
... glucosylated ribitol teichoic acid from the cell wall of S azureus RIA 1009 [24] and based on the analysis of the products formed upon acid and enzymatic hydrolysis Acid hydrolysis afforded glucose and ... internal standard, and 80% H3PO4 as the external standard for 31P NMR Presaturation of the HDO signal (1 s) was used in the accumulation of the 1H NMR spectra Two-dimensional spectra were obtained using ... were identified as alkaline hydrolysis products Acid hydrolysis afforded ribitol monophosphates and bisphosphates, anhydroribitol phosphate, anhydroribitol, ribitol, inorganic phosphate and glucose...
  • 6
  • 561
  • 0
Future R&D Environments A Report for the National Institute of Standards and Technology potx

Future R&D Environments A Report for the National Institute of Standards and Technology potx

Ngày tải lên : 23/03/2014, 01:20
... common diseases such as diabetes, asthma, and cardiovascular diseases that involve multiple genes and environmental factors, identify the most appropriate drug therapies, and even predict individual ... science and technology and what trends they found in science and technology, in the economy, and in the organization and management of industrial research and development The papers are appended to ... decade has seen major advances in designing artificial pancreases that can carry out at least some functions of the liver New materials and new understanding of mammalian cell and cell membrane...
  • 233
  • 408
  • 0
Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx

Asthma WellnessKeeping Children with Asthma in School and Learning Liability & Litigation: A Legal Primer Asthma & Indoor Air Quality (IAQ)Asthma Management, Policies and Procedures.St r a i g h tBy Paul D. Houstont a l kIn School and Healthy: docx

Ngày tải lên : 23/03/2014, 23:20
... and to ensure that decisions made regarding a child’s needs, and their implementation, are fair and appropriate It stipulates that schools and parents should act as partners in the planning and ... cockroaches, animal dander, cleaning supplies and chemicals, pesticides, perfumes and paint The EPA has launched a national public education and prevention campaign targeting asthma They provide ... 1-888-232-6789 Information and statistical data on asthma; coordinated school health programs American Academy of Allergy, Asthma, and Immunology www.aaaai.org, 1-800-822-2762 Physician referral directory,...
  • 16
  • 450
  • 0
bailin d., love a. cosmology in gauge field theory and string theory

bailin d., love a. cosmology in gauge field theory and string theory

Ngày tải lên : 24/04/2014, 17:06
... Antunes, Mar Bastero-Gil, Ed Copeland, Beatriz de Carlos, Mark Hindmarsh, George Kraniotis, Andrew Liddle, Andr´ Lukas and Paul Saffin for the particle and cosmological physics that we e have learned ... considered to be a constant That is, they are taken as standard candles and any variation in their apparent luminosity as measured on earth must be explicable in terms of their differing distances ... It is a testament to the success of the standard cosmological model that a single value of η simultaneously fits the data on all primordial abundances and allows a much more precise determination...
  • 317
  • 683
  • 0
báo cáo hóa học: " Methyl salicylate 2-O-b-D-lactoside, a novel salicylic acid analogue, acts as an antiinflammatory agent on microglia and astrocytes" docx

báo cáo hóa học: " Methyl salicylate 2-O-b-D-lactoside, a novel salicylic acid analogue, acts as an antiinflammatory agent on microglia and astrocytes" docx

Ngày tải lên : 19/06/2014, 22:20
... Resveratrol potently reduces prostaglandin E2 production and free radical formation in lipopolysaccharide-activated primary rat microglia J Neuroinflammation 2007, 4:25 15 Akundi RS, Candelario-Jalil ... DL0309 blocks degradation of IB by LPS-activated glial cells Microglia (A) and astrocytes (B) were pre-treated for h with the indicated concentrations of DL0309 LPS (0.5 μg/ml) was added and, ... Iannitelli DAE, Cataldi A, Zara S, Nasuti C, Di Stefano A: Ibuprofen and Glutathione Conjugate as a Potential Therapeutic Agent for Treating Alzheimer’s Disease Arch Pharm (Weinheim) 2010 Ray B, Lahiri...
  • 7
  • 409
  • 0
Báo cáo hóa học: " Research Article Efficient and Precise Processing for Squinted Spotlight SAR Through a Modified Stolt Mapping" doc

Báo cáo hóa học: " Research Article Efficient and Precise Processing for Squinted Spotlight SAR Through a Modified Stolt Mapping" doc

Ngày tải lên : 22/06/2014, 23:20
... 2 EURASIP Journal on Advances in Signal Processing the degradations caused by the Stolt mapping on squinted data have been identified and quantified for a zero-Doppler output geometry As a solution, ... (1) are defined as follows: (i) t and τ are slow time and fast time, respectively; (ii) R is the slant range between a point scatterer and the antenna phase center and depends on slow time and the ... of parameters and a squint angle of 20◦ , the needed bandwidth in range after the Stolt mapping is more or less twice the range bandwidth of the data before the Stolt mapping USE OF A MODIFIED...
  • 7
  • 267
  • 0
Báo cáo khoa học: "Analysis of growth and light interception of balsam fir and white birch saplings following precommercial thinning D Pothier A" doc

Báo cáo khoa học: "Analysis of growth and light interception of balsam fir and white birch saplings following precommercial thinning D Pothier A" doc

Ngày tải lên : 08/08/2014, 23:21
... forests of eastern Canada, balsam fir (Abies balsamea (L) Mill), and white birch (Betula papyrifera Marsh) were selected for this study MATERIALS AND METHODS Study area The study took place at Forêt ... but rather resulted in a decreased SLA Net assimilation rate (NAR) was increased 78% and 92% by the treatment during the first and the second growing seasons fol- Net assimilation rate (NAR) was ... products will equal RGR and NAR only if the values are calculated instantaneously (Radford, 1967) Since the values shown in tables I and II are yearly averages, multiplying these average values...
  • 10
  • 245
  • 0
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

Ngày tải lên : 12/08/2014, 03:20
... TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC ... HQT-OuterRev AAGCCNWSNAARCC CCCCANCCRAARTC GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ... GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC CACAAAACCAAAACTTCACATCCCATCC CTCACTATGGATTCTCCTAGCGGTGTCG Page 10 of 13 (page number not for citation purposes) BMC Plant...
  • 13
  • 650
  • 0
Báo cáo y học: "Mapping of IgE-binding regions on recombinant Cyn d 1, a major allergen from Bermuda Grass Pollen (BGP)" pps

Báo cáo y học: "Mapping of IgE-binding regions on recombinant Cyn d 1, a major allergen from Bermuda Grass Pollen (BGP)" pps

Ngày tải lên : 13/08/2014, 13:22
... TTGACACCAGACCAACTGGTAATG GTGAGCGGATAACAATTTCACACAG GTTCTGAGGTCATTACTGGATC CCATCCTTAAGCTTGAAGATGGGTTCGTTG GATGAGGACAAGCTTGGGCTCGCCGGAGC CTCCTCTCCAAGCTTCTTCTTGGCCCATGGC GCCATCGCCAAGCTTGGCAGCGTACTTCAC GTGAAGTACAGCGCTGCCGGCGATGGCAAC ... GTGAAGTACAGCGCTGCCGGCGATGGCAAC CTGCGCAAGAGCGCTGGCGAACTGATG GCAAGGAGCCCAGCGCTGAGTGCTCCGGC GGCGCATGGAGCGCTATGGGCGACAAGCCG GCATCAATGCAAGCTTTCAGAACTGGATC CTCCTCTCCGGATCCCTTCTTGGCCATGGC GTGAAGTACGCTGGATCCGCCGGCGATGGC ... gacaagtggctggatgcgaaggccacgttctacggcagcgacccacgtggcgcggccccc D K W L D A K A T F Y G S D P R G A A P 35 gacgaccacggcggcgcgtgcggatacaaggatgtcgacaaggcacccttcgacggcatg D D H G G A C G Y K D V D K A P F D G...
  • 12
  • 226
  • 0
Báo cáo sinh học: " SNP mapping of QTL affecting growth and fatness on chicken GGA1" pptx

Báo cáo sinh học: " SNP mapping of QTL affecting growth and fatness on chicken GGA1" pptx

Ngày tải lên : 14/08/2014, 13:22
... CTGCTTGCAGACCTCTAGGC ATACAGGCCAAGCACAGGAA CTTCCCACCAACGTTCTGTT CCAAAGCTCTGAAAGGCAAG AATTCATCCCTCCAGCACAG CTCTCTGCATGCCTTCACTG ATCCGTGGTTTGGTATTGGA CCACTTTGCTGCAGTCGTTA CACCCAAACAGTCCCATTTT ATTTGCCATGCAGCTTCTTT ... TGCAACACAAGATGCTTTCC CATGGATGCTTTCAGCTTCA TGGGCAGGTAGAGAGCTGTT CTGCTTTTCCCCTTTCTCCT GGGGGAAGACTGCTGCTTAT ATGCCAAACCACCATTGACT AGGGCTGACAGCTGGTTTTA ACTTCCAACAGCCCATTCTG CTGGCTGCAGGAGAGTAAGC AAGCTGCCAAACAAAACCAG ... AATCCCTCGTTCATGATGGT TAAGCTAGCAGGGCAGTCGT GCTCAGTTTTGGACCTGCTC GGCTTCCTCTGCACAACTTC TGTCCGGAAGAGAAGAGGAA AGCCTGGTTCCATGACAAAC GTGAGCTTCTGTGGTGCAAA CGAGAACCACTCCCATCTGT TGCATGGAGACAACTGGGTA GGGCTCCTGACGTGGTATTA...
  • 14
  • 312
  • 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"

Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"

Ngày tải lên : 25/10/2012, 10:35
... acquisition, data analysis and interpretation, and drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and CC participated in the study design, data acquisition and drafting of the manuscript ... manuscript All authors read and approved the final manuscript Available online http://ccforum.com/content/12/5/R120 Additional files The following Additional files are available online: Additional file ... measured on admission They were also measured daily in the mornings The median of all daily values and daily maximal and minimal blood glucose levels were documented Hypoglycaemic episodes of...
  • 9
  • 635
  • 0
Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"

Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"

Ngày tải lên : 25/10/2012, 10:56
... However, inflammatory reaction against the dead parasite is associated with perilesional edema, which can damage medullar parenchyma and therefore, worsen symptoms2 Inside the spinal cord, cysticercus ... patients whom are highly suspected as intramedullary cysticercosis and whose clinical courses are stable The potential advantages of medical therapy alone include avoidance of surgery and treatment ... sarcoidosis4, neoplasms such as ependymoma, and infections such as abscess21 When a patient had a history of cysticercosis or came from an endemic region and MRI revealed a cystic spinal cord...
  • 4
  • 592
  • 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Ngày tải lên : 25/10/2012, 11:00
... 881-3 18 Alehan FK, Gürakan B, Agildere M Familial arachnoid cysts in association with autosomal dominant polycystic kidney disease Pediatrics 2002; 110: e13 19 Aarhus M, Helland CA, Lund-Johansen ... et al reported that MZ with discordant handedness showed opposite brain activity patterns in language and a mental rotation task Sommer et al 14 have suggested that late splitting of the egg may ... et al Microarray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid cysts Cerebrospinal Fluid Research 2010; 7: 6-13 20 Helland CA, Aarhus M, Knappskog...
  • 4
  • 652
  • 0
Viewing a WSDL File and Testing a Web Service

Viewing a WSDL File and Testing a Web Service

Ngày tải lên : 24/10/2013, 12:15
... RetrieveCustomers() method to return a DataSet with a DataTable containing all the rows from the Customers table (see Figure 17.6) Notice that the space characters in the whereClause parameter value have been ... xmlns:mime="http://schemas.xmlsoap.org/wsdl/mime/" targetNamespace="http://DbProgramming/NorthwindWebService" xmlns="http://schemas.xmlsoap.org/wsdl/"> ... shown in Figure 17.5 Notice that the equals (=) and single quote (') characters in the whereClause parameter value of the URL have been converted to the codes % 3D and %27 respectively Figure 17.5:...
  • 7
  • 382
  • 0
Configuring a Stub Area and a Totally Stubby Area

Configuring a Stub Area and a Totally Stubby Area

Ngày tải lên : 27/10/2013, 08:15
... still have a route to 10.0.0.0/8? All external routes are filtered from stub areas and are replaced with a default route Step You decide that stub area configuration is not making a significant-enough ... route to the ABR, SanJose3 By configuring Area as a stub area, SanJose3 automatically propagates a default route into Area Use the following commands to configure the stub area: SanJose3(config)#router ... been advertised by any means Step Capetown has several interarea (IA) routes and one external (E2) route In complex OSPF networks, a large number of external and interarea routes can needlessly...
  • 5
  • 361
  • 0