... (range - 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board ofthe organization managing the orphanage gave their consent and ethical approval Materials The interview ... Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapyandthe implementation ofa new instructional system Child and Adolescent ... before in other Sub-Saharan African settings The translators were extensively trained andthe translation was discussed in detail Nevertheless, cultural bias might have influenced the findings, as...
... blot analysis demonstrated an increase in DNp73 in representative squamous cell carcinoma and adenocarcinoma samples relative tothe adjacent normal tissues DNp73 levels are affected by Sp1 and ... fibroblast cell lines (CCL171 and IMR90), and substantially increased inthe lung epithelial anaplastic carcinoma cell line (CALU6), the small cell carcinoma cell line (DMS53), the squamous lung cancer ... enhance the transactivation activities of TAp7 3a and TAp73b [39,40] In addition, lack of exon 11 in TAp73c results inthe truncation ofa second transactivation domain, located within amino acids 381–399,...
... to galvanize a national effort What are Our Goals? The overall goal ofthe NAP is to stimulate a national coordinated effort to reduce child and adolescent injury and its accompanying death and ... Unintentional injury death rates are highest for American Indians and Alaska Natives • Unintentional injury death rates are lowest for Asians or Pacific Islanders • Unintentional injury-related death rates ... developing effective educational materials, cataloging and sharing what works (best practices), and paying attention to educational needs and gaps at all levels from primary education to professional...
... the Guide for the Care and Use of Laboratory Animals ofthe National Institutes of Health andthe Animal Welfare Act under the supervision of our institutional Animal Care and Use Committee Animals ... weeks was accompanied by an increase inthe serum levels of alanine aminotransferase (ALT), indicative of progressive liver damage (Table 1) We measured a variety of serum cytokines and mediators ... course of HFC feeding demonstrated that there was an inflammatory milieu in these mice Histological analysis reveals hepatic steatosis and inflammation in HFC-fed mice Histological examination...
... Implementation Science 2009, 4:35 zation-wide training and leadership behavior modeling to bring about significant cultural change and quality and financial gains In contrast tothe number of transformational ... Both authors read and approved the final manuscript Author's information JV is a health services research doctoral candidate andthe project coordinator for the Center for Health Organization Transformation ... for Health Organization Transformation and Professor and Head ofthe Department of Health Policy and Management inthe School of Rural Public Health at the Texas A& M Health Science Center in College...
... the Guide for the Care and Use of Laboratory Animals ofthe National Institutes of Health andthe Animal Welfare Act under the supervision of our institutional Animal Care and Use Committee Animals ... weeks was accompanied by an increase inthe serum levels of alanine aminotransferase (ALT), indicative of progressive liver damage (Table 1) We measured a variety of serum cytokines and mediators ... course of HFC feeding demonstrated that there was an inflammatory milieu in these mice Histological analysis reveals hepatic steatosis and inflammation in HFC-fed mice Histological examination...
... Implementation Science 2009, 4:35 zation-wide training and leadership behavior modeling to bring about significant cultural change and quality and financial gains In contrast tothe number of transformational ... Both authors read and approved the final manuscript Author's information JV is a health services research doctoral candidate andthe project coordinator for the Center for Health Organization Transformation ... for Health Organization Transformation and Professor and Head ofthe Department of Health Policy and Management inthe School of Rural Public Health at the Texas A& M Health Science Center in College...
... was the beginning ofa pragmatic and humanitarian approach tothe treatment of drug addiction [4] In 1984, to control an outbreak of hepatitis B inthe Netherlands and pressured by the Association ... before the age of 18 years and shift to injecting very fast Heroin is the main drug of injection; however, an increasing number of people use ATS as their main drug of choice Rates of sharing of injection ... developing and adapting guidelines for the treatment of addiction, organizing advocacy workshops and supporting the secretariat ofthe Task Force The main partnership of WHO inthe country is with the...
... remote sensing image analysis saw that inthe mountainous areas in research had 420 points ofthe moving rock and soil on slope and sloping roof In particular, sloping roof on the road, including construction ... inthe mountainous areas from QT to TTH The natural - technical factors inthe mountainous areas from QT to TTH Name Sloping degrees and sloping roof , (degrees) Annual average rainfall intensity ... evaluation, thereby selected the main factors were the cause and mainly affecting conditions of landslide on slope inthe mountainous 14 areas from QT to TTh as follow (Table 3) Table The main...
... and encouragement I am also deeply grateful to my co-supervisor Associate Professor Malini Olivo, Principal Investigator ofthe Laboratory of Photodynamic Diagnosis and Treatment, National Cancer ... 4% of all skin cancers but causing almost 80% of skin cancer deaths A well-know feature of 26 malignant melanoma is that the tumor cells can spread haematogenously and lead to distant metastases ... to DC-based vaccines A notable Phase III trial was conducted to compare the efficacy of autologous peptide-pulsed DCs with dacarbazine in metastatic melanoma utilizing a cocktail of class I and...
... Cambodia, and Vietnam Andthe reason why the north American tourists come to Vietnam much more than before? Because, at this time, there is a presidential racing in America, and one of them is ... tourist coming to Vietnam at this time, and divided into three occupations: tourists from European, Oceanian and North American In general, the greatest number of tourist who coming to Vietnam recently ... humor and very easy to get an open talk with them Besides that, they also asked them for some visiting places in Hanoi, where they have to go andto see And, for only one hour, we finished our interview...
... relationships and achieve relationship marketing outcomes (Balasubramanian and Mahajan 2001; Devaraj, Porter and Sun 2006; Dholakia et al 2004; Kozinets 2002; Muniz and O’Ginn 2001; Porter and Donthu ... could inform us! • Leveraging social media to drive marketing relationships – – – – – Viral marketing via the Internet Social Networking Sites Blogging Podcasting Instant Messaging Interdisciplinary ... (Frenzen and Nakamoto 1990) • Weak ties are not that strong in B2B – The more valuable the info, the less powerful is the weak tie (Frenzen and Nakamoto 1990) – Weak ties among horizontal partners are...
... the ASEAN behind Singapore and Malaysia (Mirza and Giroud 2004) Several country-specific advantages have been pointed out as the main factors allowing Vietnam to attract such a large amount of ... for a number of key investors These data allow us to estimate separate equations for each country The FDI by provinces are available for EU, US, Japan, China, ASEAN, Thailand, Taiwan, and Singapore ... of that host country rather than in others Finally, multinationals must have the ability to internalise the O and L advantages.13 National Determinants There are only a few studies that examined...
... create associations of positive affect towards the foreign language and its speakers as well as towards the learning activities involved Learning training can help students toface up tothe emotional ... value of (3.02) The category included students regulating and managing their learning, using strategies for planning, monitoring and evaluating their learning Students reported using all the metacognitive ... approach (CALLA) Metacognitive strategies Advance organization Previewing the main ideas and concepts ofthe material to be learned, often by skimming the text for the organizing principles Advance...
... traditional markets we have to calculate to right way Thus, the Old quarter need manage and arrange again to avoid breaking space ofthe Old quarter b Entertainment in Hanoi Our team also find ... understand and popular - All in all, our team caught the interesting information, the feeling of tourists when they travel in Hanoi inthe particular and Vietnam inthe general 30 V/ RECOMMENDATIONS ... andto know what they can and don’t in Vietnam No one choose Tour Company for finding information It is very easy to understand because they are afraid of quality ofthe company Altogether, almost...
... (given in kb) was determined by kHindIII Size ofthe bands observed in each autoradiogram is indicated at the right side The 6.6 kb band detected in lanes b, c, and d in autoradiogram (B), and lanes ... but also are likely to participate inthe establishment and maintenance of an active chromatin state [18,28,29] In addition to their presence inand adjacent to active or potentially active genes, ... (Palo Alto, CA, USA) The intensity of bands on the Northern hybridization was compared by typhoon 9210 and image quant (Amersham Biosciences, Piscataway, NJ, USA) Acetylation status of H3 and H4...
... endothelial cells were incubated with probes shown in Table and Fig Arrows indicate the bands that are interacting with these probes All the lanes have labelled probes The adding of extracts and ... TAC CGC ATC ACA GTC TC GCA AAT GCG CCA GGT ACC TTC TGG GAA CTC GAG TTC CCA GAA GGT ACC TGG CGC ATT TGC CCG CCC TTT TGA GGT ACC AGA GAA CGC CTG CAG GCG TTC TCT GGT ACC TCA AAA GGG CGG CTG GGA ACT ... GGGGCGGGGCGAGC-3¢; Ets/Pea3, 5¢-GATCTCGAG CAGGAAGTTCGA-3¢; Ets (PU.1), 5¢-GGGCTGCTTG AGGAAGTATAAGAAT-3¢; Stat3, 5¢-GATCCTTCTG GGAATTCCTAGATC-3¢; and C/EBP, 5¢-TGCAGATT GGGCAATCTGCA-3¢ are from Santa Cruz Biotechnology...
... the Australian Wheat Board (AWB) tothe regime of Saddam Hussein in order to obtain contracts for the sale of Australian wheat to Iraq, involving the Department of Foreign Affairs and Trade (DFAT); ... edited a book on Westminster Legacies in Asia andthe Pacific — Westminster Legacies: Democracy and responsible government in Asia andthe Pacific He was a chief investigator ina major Australian ... Auditor-General andthe former head ofthe Department ofthe Prime Minister and Cabinet as a ‘watershed in administrative thinking and reforms’ whose ‘enduring themes have proved to 10 A failure of public...
... emerged as a distinctive group, rather than as a branch of legal practice, is attributable toa combination of state sponsorship andthe disdain of lawyers for accounting work Capitalising upon the ... about accountants’ claims to independence are routinely appeased by introducing some reforms and refinements into their self-regulatory arrangements, by updating ethical and disciplinary arrangements ... defend the authority and independence of accountancy practices in general andthe prevailing regulatory arrangements in particular But, to repeat, whenever reference is made tothe accountancy profession...
... (ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgca gtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and GateHISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgat gatgatgatgatgatgatg) The ... gccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga cat gccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatga tgatgatgatgatgatgct tatcgtcatcgtcc) The resulting ... physiological substrates, and determined the Km constants of native CPU from plasma, recombinant WT CPU and YQ CPU for Hip-Arg and bradykinin using an arginine kinase-based kinetic assay [27] Data are presented...