crossword puzzle for biological basis of genetics 1

Tài liệu English for students of Physics_Unit 1 doc

Tài liệu English for students of Physics_Unit 1 doc

Ngày tải lên : 25/01/2014, 23:20
... nm mxnx x + + = 21 6. () 1 12 12 1 xx xx yy yy − ⎟ ⎟ ⎠ ⎞ ⎜ ⎜ ⎝ ⎛ − − =− 7. 1 2 2 2 2 2 2 =++ c z b y a x 8. ()()() [ ] 2 21 2 21 2 21 zzyyxxd −+−+−= 9. ( ) 222 1 eab −= 10 . 022 22 =++++ ... president in 17 97. In 18 31 the British Association for the Advancement of Science met for the first time, followed in 18 48 by the American Association for the Advancement of Science, and in 18 72 by ... Geography 8. History 9. Information Science 10 . Linguistics 11 . Mathematics 12 . Meteorology 13 . Physics 14 . Political Science 15 . Psychology is a branch of science which/that Section...
  • 15
  • 682
  • 1
Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

Ngày tải lên : 16/02/2014, 14:20
... Commun Mass Spectrom 14 , 2080–20 81, doi: 10 .10 02 /10 97-02 31( 200 011 15 )14 : 21& lt;2080::AID-RCM120>3.0.CO;2-P [pii]. 27 Kerr JF, Wyllie AH & Currie AR (19 72) Apoptosis: a basic biological phenomenon ... Department of Biochemistry, Biosciences Institute, University College Cork, Ireland (Received 16 February 2 010 , revised 19 March 2 010 , accepted 23 March 2 010 ) doi :10 .11 11/ j .17 42-4658.2 010 .076 61. x Activation ... b- CH 3 SOH 11 y- CH 3 SOH Myr-Gly Asn Gly OxM 6 5 4 3 2 1 b ions 268.23 382.27 439.29 586.33 700.37 522.33 636.37 y ions 579.26 465. 21 408 .19 2 61. 16 14 7. 515 .26 4 01. 21 344 .19 1 2 3 4 5 6 Fig. 1. ...
  • 11
  • 580
  • 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Ngày tải lên : 19/02/2014, 13:20
... 2004) Eur. J. Biochem. 2 71, 2873–2886 (2004) Ó FEBS 2004 doi :10 .11 11/ j .14 32 -10 33.2004.0 419 8.x protein, the g rid was centered at three possible binding sites, with a 11 0 · 11 0 · 11 0 A ˚ cubic area to ... docked energy (kcalÆmole )1 ) Number of conformations in the cluster CC¢ sheet Top cavity 1 )15 .7 1 2 )15 .5 5 Top Cavity Top cavity 1 )15 .2 2 2 )13 .2 1 Bottom cavity Top cavity 1 )15 .5 1 2 )14 .9 2 Table 3. ... position of the peptide after docking Cluster Rank Lowest docked energy (kcalÆmole )1 ) Number of conformations in the cluster CC¢ sheet CC¢ sheet 1 )10 .7 2 2 )10 .0 5 Top cavity CC¢ sheet 1 )10 .4 1 2...
  • 14
  • 657
  • 0
Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

Ngày tải lên : 21/02/2014, 03:20
... performed as previously described [ 21] . However for easier hand ling of the cells, treatment was performed on HeLa cells instead of CHO K1 cells. C ells were then incubated with of 5 lgámL )1 Tat±GFP ... 272, 16 010 16 017 . 10 . Vive Á s,E.,Granier,C.,Prevot,P.&Lebleu,B. (19 97)Structure activity relationship study of the plasma membrane translocating potential of a s hort peptide from HIV -1 Tat ... omain is receptor-independent. J. Biol. Chem. 2 71, 18 188 18 193. 19 . Brugidou, J., Legrand, C., Me ry, J. & Rabie , A. (19 95) The retro- inverso form of a homeobox-derived short peptide is rapidly internalised...
  • 8
  • 485
  • 0
Tài liệu Mesoscopic Model for Mechanical Characterization of Biological Protein Materials docx

Tài liệu Mesoscopic Model for Mechanical Characterization of Biological Protein Materials docx

Ngày tải lên : 22/02/2014, 08:20
... rate μ. For this case, the force exerted on every B 15 model describes the inter-atomic potential for two C α atoms i and j in the form of () ()() ()()( ) 24 00 12 ,1 612 0, 24 4/ /1 ij ij ... Acad Sci USA 2006, 10 3, 10 248. 12 . Wilhelm, J.; Frey, E. Phys Rev Lett 19 96, 77, 25 81. 13 . Bustamante, C.; Marko, J. F.; Siggia, E. D.; Smith, S. Science 19 94, 265, 15 99. 14 . Bustamante, C.; ... may affect the estimation of Young’s modulus of biological fibers. 10 Further, for validation of our computational model for biological protein materials consisting of protein crystals, as shown...
  • 29
  • 367
  • 0
Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx

Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx

Ngày tải lên : 06/03/2014, 00:20
... contributed equally to this work (Received 28 January 2 011 , revised 18 March 2 011 , accepted 15 April 2 011 ) doi :10 .11 11/ j .17 42-4658.2 011 .0 816 5.x Inclusion bodies are insoluble protein aggregates ... VP1LAC IBs Soluble VP1LAC + (1/ 10) TSP IBs Soluble VP1LAC + (1/ 10) SPC-PI3DT IBs Soluble VP1LAC + (1/ 10) HIVP IBs Soluble LACZ Soluble LACZ + (1/ 10) VP1LAC IBs B A C Fig. 1. A nucleation ⁄ polymerization ... Garcı ´ a-Fruito ´ s et al. Biological role of bacterial inclusion bodies FEBS Journal 278 (2 011 ) 2 419 –2427 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 2427 MINIREVIEW Biological role of bacterial inclusion...
  • 9
  • 432
  • 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Ngày tải lên : 06/03/2014, 09:22
... (2005) A novel role for Vpr of human immunodeficiency virus type 1 as a regulator of the splicing of cellular pre- mRNA. Microbes Infect 7, 11 50 11 60. 35 Zhang X & Aida Y (2009) HIV -1 Vpr: a novel ... Wong-Staal F (19 91) Kinetics of expres- sion of multiply spliced RNA in early human immuno- deficiency virus type 1 infection of lymphocytes and monocytes. Proc Natl Acad Sci USA 88, 5 011 –5 015 . 13 O’Reilly ... References A2 ESSV hnRNP A1 U UAGGACAUAUAGUUAGCCCUAGG 4995–5 017 [5, 12 , 38, 40] ESE1 ASF ⁄ SF2 unknown A3 ESSp hnRNP H UGGGU 5362–5366 [48, 41, 15 , 17 , 8] ESS2 hnRNP A1 C UAGACUAGA 5428–5437 ESE2...
  • 10
  • 434
  • 0
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf

Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf

Ngày tải lên : 07/03/2014, 00:20
... CaCl 2 was 1. 8 mmolÆL )1 and 2.5 mmolÆL )1 pyruvate and 0 .1% antibiot- ics (G -13 97; 10 00 stock from Sigma-Aldrich) were added; HK: 96 mmolÆL )1 KCl, 2 mmolÆL )1 NaCl, 1 mmolÆL )1 MgCl 2 , 1 mmolÆL )1 CaCl 2 , ... mLÆL )1 methanol, 10 0 mLÆL )1 acetic acid; Destain II: 50 mLÆL )1 methanol, 70 mLÆL )1 acetic acid. ND96: 96 mmolÆL )1 NaCl, 2 mmolÆL )1 KCl, 1 mmolÆL )1 MgCl 2 , 1 mmolÆL )1 CaCl 2 , 5 mmolÆL )1 Hepes, ... significant only for the S385C mutation (GIRK1 F137SS385C : 0. 21 ± 0.04; GIRK1 F137SS401C : 0.26 ± 0.05; GIRK1 F137ST407C : Fig. 3. Effect of cAMP injections on homooligomeric GIRK1 wild- type and...
  • 9
  • 403
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Ngày tải lên : 07/03/2014, 12:20
... 50 10 0 15 0 1/ [cyt c] (µM) -1 B y = 13 5 ,11 x + 24,829 0 10 20 30 40 50 60 -0,3 -0,2 -0 ,1 0 0 ,1 0,2 0,3 1/ [L-gulono -1, 4-lactone] (mM -1 ) 1/ V 0 1/ V 0 A Fig. 3. Characterization of the ... Institute of Brussels, 642 Engeland Street, B -11 80 Brussels, Belgium Fax: +32 2 373 3282 Tel: +32 2 373 310 0 E-mail: bwolucka@pasteur.be (Received 21 June 2006, accepted 31 July 2006) doi :10 .11 11/ j .17 42-4658.2006.05443.x The ... its selectivity for l-gulono -1, 4-lactone. Our preparations of the recombinant dehydrogenase of M. tuberculosis y = 0 ,13 71x + 28,762 0 5 10 15 20 25 30 35 40 4 5 -300 -250 -200 -15 0 -10 0 -50 0 50 10 0...
  • 11
  • 571
  • 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Ngày tải lên : 08/03/2014, 08:20
... K i , NK-1m (n M )EC 50 , phospholipase C SP (1) a 1. 6 ± 0.4 8 ± 2 0 .13 ± 0.02 1. 0 ± 0.2 Propionyl[Met(O 2 ) 11 ]SP(7 11 ) a 19 00 ± 450 >5000 10 ± 2 37 ± 4 [Pro9]SP (2) a 1. 1 ± 0 .1 10 ± 2 0 .13 ± ... n M ,65CiÆmmol )1 ) for 10 0 min or [ 3 H]propionyl[Met(O 2 )11 ]SP(7 11 ) (2–5 n M ,95 CiÆ mmol )1 ) for 80 min on whole CHO cells expressing the human NK -1 receptor (6 pmolÆmg protein )1 ) as described previously ... than SP. Table 1. Affinities of b-amino acid-containing peptide analogues of SP for the NK-1M (labelled with [ 3 H][Pro9]SP) and the NK-1m (labelled with [ 3 H]propionyl[Met(O 2 )11 ]SP(7 11 )) binding...
  • 11
  • 860
  • 0
Bare rods for GMAW welding of carbon steel (1)

Bare rods for GMAW welding of carbon steel (1)

Ngày tải lên : 12/03/2014, 17:52
... specifically designed for welding creep resistant steels containing 1. 0 -1. 25Cr and 0.4-0.6Mo and operating at service temperatures up to 500C. Also used for welding heat treatable steels of similar composition ... generating industries AWS A5 .18 : ER70S-6 Copper coated, low carbon steel wire specially formulated for optimum performance under CO2 and Argon/CO2 mixed gases. Suitable for welding mild and medium ... Argon/CO2 mixed gases. Suitable for welding mild and medium strength steels. Is ideal for positional welding of sheet steel and steel pipes/tubes where high silicon content promotes smooth even...
  • 3
  • 445
  • 0
Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc

Báo cáo khoa học: Molecular basis of the unusual catalytic preference for GDP/GTP in Entamoeba histolytica 3-phosphoglycerate kinase doc

Ngày tải lên : 16/03/2014, 01:20
... protein )1 ) GDP 0.07 ± 0.03 41 ± 18 0.37 ± 0 .15 38 ± 2 ADP 7.4 ± 3.9 5.5 ± 0.8 0.5 ± 0 .17 53 ± 15 GTP 0. 016 ± 0. 01 4.5 ± 0.6 0.06 ± 0. 01 4.0 ± 0.3 ATP 5.0 ± 1. 7 1. 6 ± 0.06 0.42 ± 0.2 10 ± 1 Entamoeba GDP ... 90, 11 0 11 4. 14 Reeves RE & South DJ (19 74) Phosphoglycerate kinase (GTP). An enzyme from Entamoeba histolytica selective for guanine nucleotides. Biochem Biophys Res Commun 58, 10 53 10 57. 15 ... inhibitors (adenylyl 1, 1,5,5,-tetrafluor- opentane -1, 5-bisphosphonate), have been identified in the crystal structures of yeast [15 ,18 ], horse [29,30], pig [16 ,17 , 31] , B. stearothermophilus [19 ], T. brucei...
  • 11
  • 449
  • 0
Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

Ngày tải lên : 16/03/2014, 01:20
... D 2 O). (A) 1 H-NMR spectrum. (B) 1D- TOCSY of compound B H1 (80 ms). (C) 1D-TOCSY of compound B H2 (80 ms). (D) 13 C-HSQC spectrum (12 8 transients, 12 8 incre- ments, 1 J C,H = 14 0 Hz, 12 h). For selective ... kinetic parameters: K m = 14 .02 ± 6.05 lm; V max = 3.64 ± 1. 37 lmolÆmin )1 Æmg )1 ; k cat = 8.82 s )1 ; K i = 2.859 ± 1. 31 lm; k cat /K m = 6.3 · 10 5 m )1 Æs )1 . Structural characterization of His6-RMD from A. ... of GDP-d-perosamine. Glycobiology 11 , 655–6 61. 11 Bonin CP, Potter I, Vanzin GF & Reiter WD (19 97) The MUR1 gene of Arabidopsis thaliana encodes an isoform of GDP-d-mannose-4,6-dehydratase,...
  • 15
  • 402
  • 0
Báo cáo khoa học: Molecular basis for specificities of reactivating factors for adenosylcobalamin-dependent diol and glycerol dehydratases pptx

Báo cáo khoa học: Molecular basis for specificities of reactivating factors for adenosylcobalamin-dependent diol and glycerol dehydratases pptx

Ngày tải lên : 16/03/2014, 05:20
... [ 51] from their deduced amino acid composition and subunit structure, were 12 0 500 m )1 Æcm )1 for diol dehydratase [35], 11 2 10 0 m )1 Æcm )1 for glycerol dehydratase [49], 58 14 0 m )1 Æcm )1 for DDR ... 700–8530, Japan Fax: + 81 86 2 518 264 Tel: + 81 86 2 518 194 E-mail: toraya@cc.okayama-u.ac.jp (Received 26 May 2007, revised 17 August 2007, accepted 29 August 2007) doi :10 .11 11/ j .17 42-4658.2007.06074.x Adenosylcobalamin-dependent ... pneumoniae NCIB 418 . J Bacteriol 15 1, 5 91 599. 11 Ruch FE, Lengeler J & Lin ECC (19 74) Regulation of glycerol catabolism in Klebsiella aerogenes. J Bacteriol 11 9, 50–56. 12 Seyfried M, Daniel...
  • 11
  • 434
  • 0

Xem thêm