creating moving and removing domain controller objects in a site

New headway- rooms and objects in a house

Ngày tải lên : 30/09/2013, 13:10

... Cooker Washing machine Telephone Cupboard Cup Sofa • • • • • • • an armchair a fridge a television a coffee table a shelf a plant a stereo • • • • • • • a lamp a cooker a washing machine a telephone ... Starter Rooms in a house Living room = sitting room Bedroom Kitchen Dining room Bathroom Toilet Objects in the house Armchair Fridge Television Coffee table Bookshelf Plant Stereo Lamp Cooker ... a shelf a plant a stereo • • • • • • • a lamp a cooker a washing machine a telephone a cupboard a cup a sofa ...

21
339
2

Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc

Ngày tải lên : 27/01/2014, 15:20

... the Domain box and to automatically append the domain name to the user name If you type a domain name in User name, the domain name will be appended twice, which will cause problems with accessing ... Management and Monitoring Tools, and click Details Select the Connection Manager Administration Kit check box (as shown in the following figure), and install CMAK Install Phone Book Administrator ... Dialup in Key Name, and type in Value (as shown in the following figure), and click Apply 26 On the Advanced Customization page, click Connection Manager in Section Name, click HideDomain in...

59
1.1K
0

Process evaluation and treatability study of wastewater in a textile dyeing industry

Ngày tải lên : 05/09/2013, 17:03

... Tolerance limits for industrial effluents discharged into inland surface water, Indian Standards on Water Pollution, BIS, New Delhi, India Debabrata Mazumder was graduated in the year 1993 with Bachelor ... COD and Alkalinity A composite wastewater sample was subjected to treatability study by means of coagulation-flocculation with alum and chemical oxidation with bleaching powder [Ca(OCl)2] separately ... fabric dyeing and characterized for the relevant parameters A composite wastewater sample was prepared by mixing Jute and Cotton fabric dyeing wastewater according to their discharge ratio i.e...

14
534
0

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Ngày tải lên : 05/09/2013, 17:03

... of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu ... a wind farm of HAWT using GA gives a uniform grid arrangement similar that obtained by Grady et al [2]; this is different than that obtained by Mosetti [1] who obtained a somewhat random arrangement ... University in St Louis He received B.S in Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S in Mechanical Engineering from Washington University in St Louis in 2010 Xiaomin's...

12
635
1

Tài liệu Finding DataRowView Objects in a DataView docx

Ngày tải lên : 14/12/2013, 13:15

... SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); mySqlConnection.Open(); mySqlDataAdapter.Fill(myDataSet, ... the Find() and FindRows() methods of a DataView to find DataRowView objects */ using System; using System.Data; using System.Data.SqlClient; class FindingDataRowViews { public static void Main() ... customersDRVs array will contain one DataRowView Listing 13.2 shows a program that uses the Find() and FindRows() methods Listing 13.2: FINDINGDATAROWVIEWS.CS /* FindingDataRowViews.cs illustrates the...

5
494
0

Tài liệu COMMUNICATION FROM THE COMMISSION TO THE COUNCIL AND THE EUROPEAN PARLIAMENT Innovation in a knowledge-driven economy ppt

Ngày tải lên : 16/01/2014, 16:33

... States and sectors as a means of comparing best practice, – Translating these European guidelines into national and regional policies by setting specific targets and adopting measures, taking into ... thematic research programme and the European Association of Securities Dealers See “Growth and Employment Initiative Measures on financial assistance for innovative and job creating Small -and ... legal, fiscal and financial environment favourable to the creation and development of start-ups The interface between companies and financial markets requires attention since financial constraints,...

32
502
0

Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt

Ngày tải lên : 19/02/2014, 19:20

... University of Illinois and a German Academic Exchange Service (DAAD) Graduate Research Grant Julia Hockenmaier is supported by the National Science Foundation through CAREER award 1053856 and award 0803603 ... Hock and Brian D Joseph 1996 Language history, language change, and language relationship: An introduction to historical and comparative linguistics Berlin, New York: Mouton de Gruyter Andrew Kachites ... train a maximum entropy classiﬁer, using character 1- through 6-grams (including word boundaries) as features Since we could not manually annotate a large portion of the MZEE corpus, the training...

5
537
0

Tài liệu Báo cáo khoa học: "Domain-transcending mappings in a system for metaphorical reasoning" docx

Ngày tải lên : 22/02/2014, 02:20

... to any mappee events Mental/Emotional States VNMA: If some agents in the source domain have mappees that are also agents, then their mental and emotional states map identically, provided that ... way) We assume that there are two relevant metaphorical views: MIND IS PHYSICAL SPACE and IDEAS ARE PHYSICAL OBJECTS, containing the following relevant mappings: When a person's mind is being viewed ... the source domain, where the states of affairs themselves have mappees in the target domain, then the change event has a mappee that is a change event between the latter states of affairs Time-order...

6
455
0

The working families’ tax credit and some European tax reforms in a collective setting pdf

Ngày tải lên : 06/03/2014, 08:20

... Economic and Social Research Council is greatly appreciated The usual disclaimer applies Appendix A Personal income taxation in the UK Table A1 Income tax and National Insurance in 1998/99 Income tax ... between his and her investment/savings income, and on a vector of other characteristics Living in London and having a child aged negatively in uences the male bar gaining position Men who are better ... revenue neutral linear tax reform is characterized by a unique tax rate of 44% and a minimum guaranteed income of 3,000 euro for a single individual and 3,200 euro for each spouse in a married couple...

30
304
0

Long-term Exposure to Traffic-related Air Pollution and Type 2 Diabetes Prevalence in a Cross-sectional Screening-study in the Netherlands pdf

Ngày tải lên : 06/03/2014, 19:20

... all national, provincial and municipal authorities in the study area and were linked to a digital map of all roads in the Netherlands (NWB), using GIS Other land use data were obtained from a ... conducted using ArcInfo (ESRI, Redlands, CA) Statistical analyses Participants with missing values on exposure variables and the covariates age, gender and income were excluded from all analyses We ... to work in the area of Amsterdam, around 60 km away No freeways are present in the study area Two highways, known as provincial roads in the Netherlands, with a traffic flow of approximately 15,000...

9
771
0

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Ngày tải lên : 08/03/2014, 22:20

... the stable AKAP-bound dimerization and docking domain, and to weakly associate with another part of the molecule, possibly the tandem cAMP binding domains of the regulatory subunit [43] This association ... two basic sites, the N-terminal amide and His2 Aspartic acids Asp27 and Asp30 show lower mean pKa values than their model pKa values This may be a general property of Asp residues, as it has been ... site were computed using DDG values and experimental model pKa values, as described in Antosiewitz et al [15] Apparent pKa values for each ionizable site of RIIa D/D were calculated, taking into...

12
536
0

Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx

Ngày tải lên : 15/03/2014, 03:20

... Physicians in a Tertiary Care Hospital Doctor’s Initials: Age: Sex: Specialty: male female General Practitioner Pulmonary Internal Medicine Infectious Disease Year graduated from Medical School: ... Diagnostic standards and classification of tuberculosis in adults and children Am J Respir Crit Care Med 2000; 161: 1376-1395 Manalo MFC, Pineda AV, Montoya JC Knowledge, attitudes and practices for ... physicians' approach in the diagnosis and management of pulmonary tuberculosis To determine if there are deviations from the guidelines in TB management MATERIALS AND METHODS The study was conducted in...

10
517
1

Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx

Ngày tải lên : 17/03/2014, 01:20

... M A Walker, D J Litman, C A Kamm, and A Abella 1997 PARADISE: A framework for evaluating spoken dialogue agents In Proceedings of ACL/EACL 1997 ACL Anthology P971035 K Papineni, S Roukos, T Ward, ... in a cooperative human-robot dialogue system In Proceedings of IJCAI 2009 M Huber, M Rickert, A Knoll, T Brandt, and S Glasauer 2008 Human-robot interaction in handing-over tasks In Proceedings ... conversational agent In Proceedings of INLG 2008 ACL Anthology W08-1113 M E Foster, M Giuliani, A Isard, C Matheson, J Oberlander, and A Knoll 2009 Evaluating description and reference strategies in...

9
310
0

Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx

Ngày tải lên : 22/03/2014, 18:20

... Med, 1992; 117: 251-53 24 Yamasaki-Nakagawa M, Ozasa K, Yamada N et al: Gender difference in delays to diagnosis and health care seeking behaviour in a rural area of Nepal Int J Tuberc Lung Dis, ... delays included patient delay, institutional delay, diagnostic delay, and delay in the treatment Both patient and institutional delays result in increased infection risk for the population Diagnostic ... longer patient delay in patients aged 45 years and over and in rural patients [12] However, Liam et al showed that sex [21], age, education level, and initial symptom had no significant association...

6
466
0

Research " SUPERVISOR''''S MANAGEMENT STYLE AND EMPLOYEE PERFORMANCE APPRAISAL SATISFACTION IN A PUBLIC HEALTH AGENCY " pptx

Ngày tải lên : 23/03/2014, 05:23

143
278
0

Báo cáo khoa học: "Combining POMDPs trained with User Simulations and Rule-based Dialogue Management in a Spoken Dialogue System" docx

Ngày tải lên : 23/03/2014, 17:20

... Higashinaka, M Nakano, and K Aikawa 2003 Corpus-based discourse understanding in spoken dialogue systems In ACL-03, Sapporo, Japan Visualization Tool E Levin, R Pieraccini, and W Eckert 2000 A stochastic ... mines the where au,t+1 is the true user action Rule-based Dialogue Management A rule-based dialogue manager was developed as a meaningful comparison to the trained DM, to obtain training data ... detailed conversational context The database concentrates heterogeneous types of information at various levels of description in a uniform way This facilitates dialog evaluation, data mining and...

4
269
0

Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Ngày tải lên : 30/03/2014, 13:20

... kb DNA fragment, containing the sequence encoding the ectodomain of gp41 of HIV isolate LAI (amino acids 537–669), was obtained by PCR ampliﬁcation using, as template, a plasmid containing the ... part, site- directed mutagenesis data of gp41 are presented with the aim of assessing the in uence of amino acid replacements on protein stability and solubility Materials and methods Materials ... 5¢-CTCTTTCATGACGCTGACGGTA CAGGCC-3¢; reverse primer: 5¢-CCGCTCGAGCTAATG GTGATGGTGATGGTGTGACCCTCCCCCTCCACT TGCCCATTTATCTAA-3¢ The start codon in the forward primer (in bold) is a naturally occurring...

14
375
0

Báo cáo hóa học: "Evaluation, diagnosis, and treatment of lead poisoning in a patient with occupational lead exposure: a case presentation" pptx

Ngày tải lên : 20/06/2014, 00:20

... smoked in the working place, which was having poor housekeeping practices and minimum engineering control, lacking local and general exhaust ventilation and washing facilities culminating into alarmingly ... synthesis and elevated levels of the precursor δ-aminolevulinic acid (ALA), which is a weak gamma-aminobutyric acid (GABA) agonist that decreases GABA release by presynaptic inhibition [6,7] Lead is ... clothes and no separate areas were provided for the removal and storage of the lead-contaminated protective work clothing and equipment The regulatory body should make it mandatory to evaluate and...

4
542
0

báo cáo hóa học:" Osteoarthritis: quality of life, comorbidities, medication and health service utilization assessed in a large sample of primary care patients" potx

Ngày tải lên : 20/06/2014, 00:20

... (PHQ-scores), and HSU were made by ANCOVAs adjusted for covariates that may have substantial influence such as age, disease duration, comorbidities and QoL (AIMS2-SF scales assessing pain, physical limitation ... covariates as mentioned above More than a quarter of the patients received some acupuncture during the last half year and nearly a quarter visited a traditional healer at least once ANCOVAs revealed ... findings is that no control group was available Regarding pain medication, Paracetamol, which is the first choice treatment according to most guidelines, was only marginally prescribed The main...

9
413
0

Báo cáo toán học: " System for fast lexical and phonetic spoken term detection in a Czech cultural heritage archive" docx

Ngày tải lên : 20/06/2014, 21:20

... trigram language model described in Section 3.3 and clustered DT adapted acoustic models that are automatically gradually adapted to each individual speaker This unsupervised iterative speaker adaptation ... rare personal and place names and just as they are underrepresented in the language model training data, they are also very important to the searchers Page of 11 of the collection [28] (in fact, ... emotional and contains many disfluences and non-speech events such as crying or whimpering The speaking rate also varies greatly depending on the speaker, which again is frequently an issue related...

11
377
0