creating a project and adding the program code to preview video and audio
mac application development by example
Ngày tải lên :
24/04/2014, 15:29
... adding the program code to preview video and audio Capturing a single frame as a still image Time for action – capturing a frame Previewing audio capture Time for action – capturing and saving images ... be creating applications the same way Mac OS X itself is created Our application will automatically inherit the behavior and appearances of Mac OS X Using Cocoa with Xcode IDE is the best way to ... template to create an App, Xcode creates a project that will build a fully functional App The App will display a menu bar, display a window, allow us to drag the window around and even present an...
- 318
- 685
- 0
Using Server Controls in ASP.NET AJAX
Ngày tải lên :
05/10/2013, 10:20
... sophisticated apps that need logical and physical separation of the data tier that has complex data objects and a data access layer Summary The ToDo List application is an excellent example of an ASP.NET ... with the database An ObjectDataSource control allows you to create a declarative link between your web page controls and data access components that query and update data The control contains ... IN ASP.NET AJAX the dataset and with inline editing capability that allow these fields to be changed Because the grid is bound, changes to the underlying dataset trigger a refresh to the grid and...
- 22
- 592
- 0
Module 2: Using Web Controls
Ngày tải lên :
27/10/2013, 07:15
... available in ASP.NET Lead-in There are five validation controls that ship with ASP.NET ! RequiredFieldValidator ! CompareValidator ! RangeValidator ! RegularExpressionValidator ! CustomValidator ... ValueToCompare to compare to a constant value Set ControlToCompare to the ID of another control to compare against If you set both ValueToCompare and ControlToCompare, ControlToCompare takes ... controls on a form Add a form (runat="server") to the page to hold the controls Run the page and show that the view state is now preserved Also show the additional tags and attributes added to the control...
- 34
- 373
- 0
Tài liệu Using Common Dialog Controls ppt
Ngày tải lên :
15/12/2013, 00:15
... buttons Modal dialog boxes also have a DialogResult property that indicates which button the user clicked (the Save dialog has a Save button and a Cancel button) The ShowDialog method returns the ... object rather than a file The StringBuilder class provides a very efficient way for creating and manipulating strings It has many of the same features as the string type, but also allows you to easily ... easily add and remove characters in a string By the end of this block of code, the data variable contains the information ready to be sent to the printer NOTE In the NET Framework and C#, the string...
- 7
- 349
- 0
Tài liệu Using Windows Controls docx
Ngày tải lên :
24/12/2013, 01:17
... Table 6.2: COMMONLY USED WINDOWS FORM CONTROLS CONTROL DESCRIPTION ComboBox Combines an editable field with a list box In the next section, you'll learn how to use a DataGrid control to access ... list box In the next section, you'll learn how to use a DataGrid control to access the rows in a database table ...
- 2
- 303
- 1
Tài liệu Edit and Update Using Data Bound Controls pdf
Ngày tải lên :
24/12/2013, 06:17
... passing in the dataset called dsCustomerIndividual, and specifying the Customers table Then the Update method is called off the data adapter called odaCustomerIndividual, passing the same parameters ... If the user then clicks the btnSave button, the data is updated to the dataset and then back to the server If the user clicks the btnCancel button, the edits are canceled In both cases, the ActivateEditing ... updates the changes back to the dataset Finally, the dataset changes are sent backto the server Listing 1.9 frmHowTo1_4.vb: Saving the Data Back to the Server Private Sub SaveRecord() '- Use the...
- 7
- 339
- 0
Tài liệu Validate Data Using Validation Controls docx
Ngày tải lên :
24/12/2013, 06:17
... Validator ControlToValidate txtRangeExample MaximumValue 10 MinimumValue ErrorMessage RangeValidator txtCompareSecond Here is the message for the Range Validator RegularExpressionValidator ControlToValidate ... (Enter a State Other Than WA or CA) TextBox ID txtCustomExample Button ID btnTestValidators Text Test Validators Label Text Page Validation Errors RequiredFieldValidator Control ToValidate txtRequiredExample ... System.Object, ByVal e As System.EventArgs) Handles btnTestValidators.Click ' Forces the Validation controls to validate Page.Validate() If Page.IsValid Then ' Code if all controls are valid Else ' Code...
- 6
- 365
- 0
Tài liệu Add and Delete Records Using Bound Controls ppt
Ngày tải lên :
21/01/2014, 12:20
... Next, the Update method of the odaCustomerIndividual adapter is used to call the DELETE SQL statement command against the dataset, deleting the actual rows in the data set The AcceptChanges method ... with the AddNew method of the BindingContext, and the text boxes are enabled for editing If the user then clicks the btnSave button, the data is updated to the dataset and then back to the server ... the user clicks the btnCancel button, the edits are canceled In both cases, the mbAddNew variable is set to False and the ActivateEditing routine is called to disable the text boxes and let the...
- 5
- 241
- 0
Báo cáo toán học: " On transmission performance of OFDM-based schemes using MMSE-FDE in a frequencyselective fading channel" pot
Ngày tải lên :
20/06/2014, 21:20
... interleaved before data modulation A block interleaver used as channel interleaver in the simulation is of size 2a and 2b block interleaver, where a and b are the maximum allowable integers for a ... conventional OFDM are almost the same On the other hand, the total (i.e., transmitter/receiver) complexity of OFDM/TDM is Gacanin and Adachi EURASIP Journal on Wireless Communications and Networking ... so that real and imaginary part of Gacanin and Adachi EURASIP Journal on Wireless Communications and Networking 2011, 2011:193 http://jwcn.eurasipjournals.com/content/2011/1/193 Page of 10 the...
- 10
- 482
- 0
Báo cáo hóa học: "Distortion outage minimization in Nakagami fading using limited feedback" docx
Ngày tải lên :
20/06/2014, 22:20
... outage performance with no CSIT and full CSIT substantially We also study the asymptotic behavior of the outage probability and diversity gain as the available average power becomes unlimited and ... formulation to estimate a random field where the data collected by the sensors are spatially correlated, and/ or the fading channels from the clusterheads to the FC are correlated instead of being ... that the instantaneous distortion D at the FC (which, for a given fading block is a random variable) exceeds a maximum allowable distortion threshold D max , or in mathematical notation, P outage...
- 16
- 260
- 0
Báo cáo hóa học: "Research Article Signal Classification in Fading Channels Using Cyclic Spectral Analysis" ppt
Ngày tải lên :
21/06/2014, 22:20
... is assumed that the SNR of the signal on each antenna can be accurately estimated, and that the channel phase offset between antennas is accurately determined for the slow flat fading channel The ... HOCS-based processing is also implemented in a hierarchical approach to maximize the ability to accurately determine the class of a signal before further narrowing the list of candidate modulations ... conditions, with an SNR range of dB to 15 dB The channel models simulated include a flat fading channel, twopath fading channel, and a harsh 20-path fading channel Each of the fading channels implemented...
- 14
- 311
- 0
Báo cáo hóa học: " Research Article Statistical Analysis of Multipath Fading Channels Using Generalizations of Shot Noise" pot
Ngày tải lên :
22/06/2014, 00:20
... quasistatic channels (1) Clearly, the rate of the Poisson process is an important parameter which shapes the statistics of the received signal, and therefore the multipath delay profile and the ... conjectured that for a large number of paths the inphase and quadrature components of the received signal are Gaussian Some authors argue that the lowpass representation of the band-limited channel impulse ... i≥1 are uncorrelated Clearly, the above calculations hold for the low-pass equivalent complex representation as well, leading to the following Charalambos D Charalambous et al results The above...
- 9
- 217
- 0
Báo cáo hóa học: " Research Article Cross-Layer Design for Video Transmission over Wireless Rician Slow-Fading Channels Using an Adaptive Multiresolution Modulation and Coding Scheme" pptx
Ngày tải lên :
22/06/2014, 19:20
... where the data from the base layer are mapped to the coarse resolution layer of the signaling constellation while the data from the enhancement layer are mapped to the finer resolution layer of the ... knows the channel conditions, it will adjust all the parameters based upon the operational rate-distortion characteristics available at the transmitter side We include the ability of the adaptive ... modulation and coding scheme to send video to a remote receiver We assume that CSI is available such that the transmitter can adapt the transmission parameters based on this knowledge Once the transmitter...
- 12
- 351
- 0
Báo cáo hóa học: "Optimal Training for Time-Selective Wireless Fading Channels Using Cutoff Rate" potx
Ngày tải lên :
22/06/2014, 23:20
... identity matrix, and (e) |a| denotes the absolute value of the scalar a, |A| denotes the determinant of the matrix A, and |A| denotes the cardinality of the set A (the context will make use of ... to distinguish between the cases of causal and noncausal estimation (1) Causal estimation At high SNR, the optimal training period for any causal estimator is found from (23) Taking the argmax ... (23) a simple expression for the interleaved cutoff rate that is parameterized by an arbitrary channel correlation, channel estimation scheme, and the allocation of power and bandwidth to training...
- 15
- 221
- 0
Báo cáo hóa học: " Adaptive Blind Multiuser Detection over Flat Fast Fading Channels Using Particle Filtering" doc
Ngày tải lên :
23/06/2014, 00:20
... statistics of the underlying channel, based on which a mathematical tractable approximation using autoregressivemoving-average (ARMA) model is adopted The approximation enables a dynamic state-space modeling ... IEEE and SPIE and has been invited to lecture at universities in the United States and overseas He is the Area Editor of special issues of the Signal Processing Magazine and Associate Editor of the ... Spain, and an Assistant Professor in the Universities of Malaga and Granada from 1991 to 1998 Now Dr Diego P Ruiz is an Associate Professor within the Systems, Signals and Waves Research Group of the...
- 11
- 222
- 0
Báo cáo y học: " Comparison of exhaled breath condensate pH using two commercially available devices in healthy controls, asthma and COPD patients" pptx
Ngày tải lên :
12/08/2014, 14:20
... Statistical analysis Analysis of repeatability and reproducibility was done according to Bland Altman[15,16]] The reproducibility of the pH values by ECoScreen and RTube was assessed from the ... first calculated the standard deviation of the differences between the averaged measurements for the two devices according to Bland-Altman The respective variance is given as mean of the within-subject ... prior to analysis, or the use of a special gas [5] We included stable asthmatics and COPD GOLD stage and Comparing the asthmatic and COPD patients with healthy controls, we did not find significantly...
- 8
- 271
- 0
Báo cáo sinh học: "Refining motifs by improving information content scores using neighborhood profile searc" ppt
Ngày tải lên :
12/08/2014, 17:20
... GGAAATTGCAGCCTCAGCCC CTGCAATTTCGCGCCAAACT CCCTCTGCGCCCGGACCGGT CCATATTAGGACATCTGCGT GTATTTCCCGTTTAGGAAAA TGTGANNNNGNTCACA CCTCAGCCC ATTTCNNGCCA TGCRCYCGG CCATATTAGAGACTCT TTTCCCNNTNAGGAAA Page 13 ... 176.7 186.9 218.8 CCCGGGAGCTG ATACCAGGGTC CCTCGGGTTTGTC GACCTTGGGTATT CCGAAAGGACTGCGT TGAGAGATGCCTATG CAGTAGCAAAGACTTCC ATTGCGAAAGAATGTGG CATTTAGCTGAGTTCACCTT CGTCACTTAGTCGCGCCATG 153.3 153.6 158.7 ... CCGAAAAGAGTCCGA TGGGTGATGCCTATG TTGTAGCAAAGGCTAAA ATCGCGAAAGGTTGTGG CTGGTGATTGAGATCATCAT GGTCACTTAGTGGCGCCATG 125.1 145.7 142.6 158.3 147.5 164.6 143.3 174.1 165.9 216.3 CCCGGTCGCTG ATACCAGTTTC...
- 14
- 179
- 0
Báo cáo sinh học: "Refining transcriptional regulatory networks using network evolutionary models and gene historie" docx
Ngày tải lên :
12/08/2014, 17:20
... Kellis M: Transcriptional regulatory code of a eukaryotic genome Nature 2004, 431:99-104 26 Kanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S, Katayama T, Araki M, Hirakawa M: From ... Authors’ contributions XZ designed, implemented, and ran all simulation and refinement methods; XZ and BMEM collaborated closely in the elaboration of the project, the analysis of the data, and ... simulated data allows us to get absolute evaluation of our refinement algorithms, specific precautions need to be taken against systematic bias during data simulation and result analysis We use a...
- 12
- 587
- 0
Recovering mailbox user using dial tone recovery
Ngày tải lên :
14/08/2012, 08:51
... Backup Mailbox Database Giả lập Mailbox Database bị lỗi Tạo Dial-tone Database Chuyển sang dùng dial-tone database thay cho mailbox database bị lỗi Tạo Mailbox Database restore mailbox database ... backup file Chuyển trở dùng mailbox database thay cho dial-tone database Merge liệu từ Dial-Tone Database vào Mailbox Database X a Dial-Tone Recovery Dial-tone Databse II Thực hiện: Backup Mailbox ... dial-tone database thay cho mailbox database lỗi: - Vào Exchange Management Shell, gõ lệnh Get-Mailbox –Database “SerEx2k7\Mailbox Database” | Move-mailbox –ConfigurationOnly –TargetDatabase “SerEx2k7\Mailbox...
- 26
- 635
- 0
Using Net Beans 5.0
Ngày tải lên :
17/08/2012, 09:18
... in the project' s Ant script The IDE contains the following standard project templates: Java application icon Java application icon Java application icon Java Application Template for creating a ... Library Manager, the IDE automatically adds the Javadoc and source files to the project when you register the JAR file on a project' s classpath You can step into classes and look up Javadoc pages ... have a target for that command, the IDE can generate the target for you When the IDE generates the target, the target is generated in a separate build script and automatically mapped to the command...
- 104
- 775
- 0