create a queue class use an arbitrary name by selecting option 3 and for this exercise e
báo cáo hóa học: " Health predicting factors in a general population over an eight-year period in subjects with and without chronic musculoskeletal pain" potx
Ngày tải lên :
18/06/2014, 19:20
... population for each subscale (1 ≥ mean and < mean) The analyses were done with simple contrast to a reference group for each of the independent variables At baseline the analyses were checked for ... feeling rested after sleep, was regarded to represents a more qualitative aspect of non-restorative sleep and was introduced separately in the analyses as feeling rested Sleep problems were assessed ... interaction between sex or age and all of the independent variables Subjects with missing values for any of the variables were rejected from the analyses The actual number of subjects in each analysis...
- 9
- 368
- 0
báo cáo hóa học:" Health predicting factors in a general population over an eight-year period in subjects with and without chronic musculoskeletal pain" pot
Ngày tải lên :
20/06/2014, 16:20
... population for each subscale (1 ≥ mean and < mean) The analyses were done with simple contrast to a reference group for each of the independent variables At baseline the analyses were checked for ... feeling rested after sleep, was regarded to represents a more qualitative aspect of non-restorative sleep and was introduced separately in the analyses as feeling rested Sleep problems were assessed ... interaction between sex or age and all of the independent variables Subjects with missing values for any of the variables were rejected from the analyses The actual number of subjects in each analysis...
- 9
- 311
- 0
A study on english reading strategies employed by second year bridge and road students university of transport and communications
Ngày tải lên :
29/01/2014, 10:33
... of all three scores from the mean The students whose mean scores were above were regarded as good readers, those with mean scores of to were classified as average readers and those with mean ... The mean responses of both good readers and bad readers were relatively equal (4.5 for good readers and 4.1429 for bad readers) Therefore, both good readers and bad readers thought that reading ... reader 4 3. 5 3. 83 0.21 Bad reader 4 3. 5 3. 5 0.40 Bad reader 3. 5 3. 5 3. 33 0.21 Bad reader 3 3.5 3. 16 0.22 Bad reader 3 2.5 2.8 0.41 Average readers Bad readers The classification of good readers,...
- 79
- 668
- 0
báo cáo hóa học:" ST6Gal-I expression in ovarian cancer cells promotes an invasive phenotype by altering integrin glycosylation and function" pptx
Ngày tải lên :
20/06/2014, 07:20
... Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived ... peroxidase-coupled secondary antibody (Amersham, Piscataway, NJ) The labeled proteins were visualized with enhanced chemiluminescence, and subsequent images were scanned with a HewlettPackard Scanjet 5470 ... receptor-alpha and -beta, progesterone receptor, and androgen receptor mRNA in normal and malignant ovarian epithelial cells Proc Natl Acad Sci USA 1999, 96:5722-5727 Lessan K, Aguiar DJ, Oegema T,...
- 8
- 237
- 0
Thesis for the degree of Doctor of Education in TESOL EFL Female Emirati Students’ Perception of the Use of an Interactive Mathematics Software Program in a CLIL Class at the Tertiary Level
Ngày tải lên :
11/10/2014, 04:19
... the targeted language they are learning Indeed, the approach had to remain consistent with integrated language and content learning because both emphasize meaningful engagement and authentic language ... continued encouragement and endorsement of studying an alternative pedagogy to the more traditional teachercentered approach helped to make me a better teacher and benefited the students tremendously ... (Bb), an educational tool purchased by the UAE college of my employment that allows classes to be created as computer-based and available to the various campuses, system-wide, and at any time as...
- 208
- 350
- 1
Báo cáo y học: "Users' guides to the medical literature: how to use an article about mortality in a humanitarian emergency"
Ngày tải lên :
25/10/2012, 10:31
... Contre la Faim, and the International Rescue Committee You also request a search of peer-reviewed and non-peer-reviewed literature using PubMed, Evidence-AID, and common electronic medical databases ... realm of humanitarian emergencies, there have been, until recently, relatively few efforts to collect, report and appraise evidence This dearth of evidence has resulted in confusion about the ... (allage, all-cause, non-standardised), age-specific (children under particularly), and cause-specific mortality They may also present an absolute estimate of excess deaths 3) Will the results help...
- 9
- 694
- 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx
Ngày tải lên :
15/12/2013, 06:15
... the same forever The nature of life is change, so the sooner we accept this fact and use it to our personal advantage, the better People who are successful and happy are people who have mastered ... disappointment Since change is inevitable, no one can stop the changes in life However, we can always choose to change for the better We can always change for personal and spiritual growth Here ... and be in awe at the achievements of these ancient sages if we not think that their achievements are truly great? But it is a greatness we ourselves can achieve as well We just need to walk this...
- 59
- 770
- 3
Tài liệu Create a Class That Implements the Interface You Defined docx
Ngày tải lên :
24/12/2013, 06:17
... exists because one class can implement many interfaces, and those interfaces can have public members of the same name Although typing Implements ICustomer.[Property/Method Name] after a property and ... samples for this chapter, I want to use the same form for each section's code samples without having to re -create the form each time To this end, I have used frmHowTo9xBase as a base form class, and ... made several changes to property declarations, and it's worth enumerating them here First, the Get and Set code blocks are wrapped up in one Property declaration, making neater and easier-to-read...
- 9
- 325
- 0
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
Ngày tải lên :
28/03/2014, 23:20
... 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC -3 ; and mm0 632 rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC -3 The gene mm0 632 was cloned via BsaI restriction sites in plasmid pASK-IBA3 (IBA GmbH, ... lateral gene transfer between bacteria and archaea J Mol Microbiol Biotechnol 4, 4 53 461 Tholen A, Pester M & Brune A (2007) Simultaneous methanogenesis and oxygen reduction by Methanobrevibacter ... the standard aerobic xanthine ⁄ xanthine oxidase assay in the presence of Nitro Blue tetrazolium [18] Superoxide generated by xanthine oxidase reduces Nitro Blue tetrazolium to blue formazan, which...
- 10
- 539
- 0
Báo cáo y học: "Clinicians'''' evaluations of, endorsements of, and intentions to use practice guidelines change over time: a retrospective analysis from an organized guideline program" doc
Ngày tải lên :
11/08/2014, 05:21
... surgeons, and other medical specialists) and methodological experts; interpretation and consensus of the evidence by the team; development of recommendations; and formal standardized external review ... clinicians' evaluations of, endorsements of, and their intentions to use cancer CPGs developed by an established cancer CPG program; and evaluate how clinician characteristics and clinician beliefs ... of the CPG characteristics and messages and the CPG development process, actual and perceived facilitators and barriers to implementation, and factors related to norms and the practice context...
- 10
- 228
- 0
báo cáo khoa học: " Clinicians'''' evaluations of, endorsements of, and intentions to use practice guidelines change over time: a retrospective analysis from an organized guideline program" pot
Ngày tải lên :
11/08/2014, 16:20
... surgeons, and other medical specialists) and methodological experts; interpretation and consensus of the evidence by the team; development of recommendations; and formal standardized external review ... clinicians' evaluations of, endorsements of, and their intentions to use cancer CPGs developed by an established cancer CPG program; and evaluate how clinician characteristics and clinician beliefs ... of the CPG characteristics and messages and the CPG development process, actual and perceived facilitators and barriers to implementation, and factors related to norms and the practice context...
- 10
- 269
- 0
How to create a yum
Ngày tải lên :
18/09/2012, 09:12
... /mnt/dvd/Server/createrepo-0.4.11 -3. el5.noarch.rpm Create yum repository Create metadata • Create yum repository: # cd /mnt/ # createrepo Define yum repository Create yum repository define file /etc/yum.repos.d/dvdiso.repo: [MailRepo] name= MailRepo ... Find and install 'createrepo' package in /mnt directory: # find /mnt -iname 'createrepo*' /mnt/dvd/Server/createrepo-0.4.11 -3. el5.noarch.rpm # rpm -ivh /mnt/dvd/Server/createrepo-0.4.11 -3. el5.noarch.rpm ... /etc/yum.repos.d/dvdiso.repo: [MailRepo] name= MailRepo baseurl=file:///mnt/ enabled=1 gpgcheck=0 Test it # yum clean all # yum list If 'yum list' list all packages in DVD/CD disks or ISO images, it works :) ...
- 2
- 626
- 0
How to create a Raid Device using Madadm
Ngày tải lên :
19/09/2012, 09:21
... you want to create additional devices[ie there exists a /dev/md0] you may need to add an "a yes" option to the mdadm command For example, #mdadm create /dev/md1 -a yes level=0 raid-devices=2 ... something in /raid5 and delete one of partitions of sda5,sda6,sda7 This is how we can create a Raid device with level ***RAID 1*** #mdadm create /dev/md0 level=1 raid-devices=2 /dev/sda{5,6} This is ... thus increasing the read performance But can be utilize only 50% of the total size Level 5: It is a combination of striping and parity Need at least three hard disks Both parity and data are distributed...
- 3
- 953
- 0
Phân tích hiệu quả tín dụng công thương nghiệp và tiêu dùng tại Ngân hàng Á Châu - chi nhánh An Giang
Ngày tải lên :
02/11/2012, 10:53
... chi nhánh An Giang Xin chân thành cảm ơn: - Quý thầy cô Khoa Kinh Tế - Quản Trị Kinh Doanh Trường Đại Học An Giang - Thầy Bùi Thanh Quang - Ban lãnh đạo Ngân hàng Á Châu chi nhánh An Giang: + Ông: ... viết tắt sau: ACB : Asia – Commercial - Bank CN : Cá nhân CP : Chi phí CTN : Công thương nghiệp DN : Dư nợ DNTN : Doanh nghiệp tư nhân DSTN : Doanh số thu nợ DSCV : Doanh số cho vay DT : Doanh thu ... 32 3. 2.2.2 Theo thành phần kinh tế 34 3. 2 .3 Phân tích dư nợ cho vay CTN TD 38 3. 2 .3. 1 Theo thời hạn tín dụng 38 3. 2 .3. 2 Theo thành phần kinh tế 40 3. 2.4...
- 75
- 486
- 0
Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering
Ngày tải lên :
06/11/2012, 10:35
... and/ or accepted journal and conference papers: Anh T N and Hosoda T.: Depth-Averaged model of open channel flows over an arbitrary 3D surface and its applications to analysis of water surface profile ... depth-averaged model in Cartesian coordinates and introduced the curved river boundary to the model through steps Tingsanchali and Mahesawaran (1990) presented a mathematical depth-averaged model for ... coordinate criteria, the depth-averaged models can be classified into two groups namely: the depth-averaged models in Cartesian coordinate system and the depth-averaged models in generalized curvilinear...
- 127
- 595
- 0
Thực trạng và biện pháp nâng cao công tác thẩm định tín dụng tại Ngân hàng TMCP Á Châu – Chi nhánh An Giang
Ngày tải lên :
29/11/2012, 09:16
... lãnh cu a người khác mà chỉ dư a vào uy tín cu a bản thân khách hàng vay vốn để quyết định cho vay - Cho vay có bảo a m: Là loại cho vay dư a sở các bảo a m tiền vay thế ... dụng tại Ngân hàng TMCP A Châu – Chi nhánh An Giang để từ đề những giải pháp và kiến nghị nhằm nâng cao nư a hiệu quả công tác thẩm định tín dụng tại chi nhánh thời gian tới Trang ... nhanh An Giang Để đáp ứng nhu cầu vốn Ngân hàng TMCP A Châu – CN An Giang đóng góp phần việc đầu tư khoản tín dụng vào kinh tế Ngân hàng TMCP A Châu – CN An Giang là Ngân hàng được a nh...
- 88
- 1.2K
- 7
Phân tích hoạt động tín dụng tại ngân hàng thương mại cổ phần á châu chi nhánh an giang
Ngày tải lên :
05/04/2013, 08:51
... hạn ACB – An Giang 38 Biểu đồ 4.4: Doanh số cho vay theo thành phần kinh tế ACB – An Giang 40 Biểu đồ 4.5: Doanh số cho vay theo ngành nghề kinh doanh ACB – An Giang 42 Biểu đồ 4.6: Doanh ... ACB – An Giang 40 Bảng 4.5: Doanh số cho vay theo ngành nghề kinh doanh ACB – An Giang 42 Bảng 4.6: Doanh số thu nợ theo thời hạn ACB – An Giang 45 Bảng 4.7: Doanh số thu nợ theo thành ... ACB – An Giang 52 Bảng 4.11: Dư nợ theo ngành nghề kinh doanh ACB – An Giang 53 Bảng 4.12: Nợ hạn ACB – An Giang 55 Bảng 4. 13: Các tiêu đánh giá hiệu hoạt động ACB – An Giang ...
- 78
- 805
- 3
PHÂN TÍCH HOẠT ĐỘNG TÍN DỤNG CÁ NHÂN TẠI NGÂN HÀNG TMCP Á CHÂU CHI NHÁNH AN GIANG
Ngày tải lên :
15/04/2013, 21:51
... 2009) .24 4 .3. 1 Doanh số cho vay ACB An Giang 24 4 .3. 2 Doanh số thu nợ ACB An Giang 25 4 .3. 3 Dư nợ cho vay ACB An Giang 27 4 .3. 4 Nợ hạn ACB An Giang .29 4.4 Thực trạng ... tín dụng ACB An Giang giai đoạn 2007 – 2009 4 .3. 1 Doanh số cho vay ACB An Giang Bảng 4 .3 Doanh số cho vay ACB An Giang giai đoạn (2007 – 2009) ĐVT: Triệu đồng Chỉ tiêu 2007 2008 Cá nhân Doanh nghiệp ... gia tăng doanh số cho vay KH doanh nghiệp ACB An Giang Trong năm 2009, doanh số cho vay KH doanh nghiệp gia tăng với tốc độ nhanh so với doanh số cho vay KH cá nhân Tuy nhiên doanh số cho vay...
- 66
- 1.1K
- 5
Phân tích hoạt động tín dụng ngắn hạn tại ngân hàng thương mại cổ phần Á Châu- chi nhánh An Giang
Ngày tải lên :
17/04/2013, 16:46
... vốn ACB – An Giang 29 Biểu đồ 3. 3: Doanh số cho vay ngắn hạn ACB – An Giang 32 Biểu đồ 3. 4: Doanh số cho vay ngắn hạn theo thành phần kinh tế 33 Biểu đồ 3. 5: Doanh số cho vay ... qua năm 2007-2009 ACB – An Giang 24 Bảng 3. 1: Cơ cấu nguồn vốn ACB – An Giang 27 Bảng 3. 2: Tình hình huy động vốn ACB – An Giang 29 Bảng 3. 3: Doanh số cho vay ngắn hạn ACB – An ... Giang 31 Bảng 3. 4: Doanh số cho vay ngắn hạn theo thành phần kinh tế 34 Bảng 3. 5: Doanh số cho vay ngắn hạn theo mục đích vay vốn 35 Bảng 3. 6: Doanh số thu nợ ngắn hạn ACB – An...
- 73
- 496
- 1